Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pIR3DH8K Resource Report Resource Website |
RRID:Addgene_165069 | gal80Arm1-P-TPI1-KanMX4-gal80Arm2 | Other | Ampicillin | PMID:33594068 | Vector Backbone:pUC19; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | WT | 2026-08-29 12:59:22 | 0 | |
|
pBK-CMV Pig10 Resource Report Resource Website |
RRID:Addgene_16504 | Pig10 | Homo sapiens | Ampicillin | PMID:9305847 | Backbone Marker:Stratagene; Backbone Size:4500; Vector Backbone:pBK-CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 12:59:22 | 0 | ||
|
pJT9RFR Resource Report Resource Website |
RRID:Addgene_165067 | T-RPL3>ERG20>P-GAL1-P-GAL2>Y-FAST>ErB1.2A-AcNES1>T-RPL41B | Other | Ampicillin | PMID:33594068 | Please note Addgene NGS result identified several mutations in LEU2- V73A, A82G, L199V, D304N. Depositor confirms this does not affect plasmid function. On the contrary the depositor has found "significant improvement on the productivities in the strain harbouring this plasmid." | Vector Backbone:pRS425; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | WT | 2026-08-29 12:59:22 | 0 |
|
pCRII Pig9 Resource Report Resource Website |
RRID:Addgene_16503 | Pig9 | Homo sapiens | Ampicillin | PMID:9305847 | Backbone Marker:Invitrogen; Backbone Size:3900; Vector Backbone:pCRII; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Partial cDNA clone | 2026-08-29 12:59:23 | 0 | |
|
Vg4-Luc Resource Report Resource Website |
RRID:Addgene_16501 | Mad-binding element from Vg | Ampicillin | PMID:9660945 | Four copies of the Mad-binding element from Vg (GCTTGGACTGCCGTCGCGATTC) are cloned into pGL3. | Backbone Marker:Promega; Backbone Size:5010; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-29 12:59:21 | 0 | ||
|
SBE2-Luc Resource Report Resource Website 1+ mentions |
RRID:Addgene_16500 | Smad binding element | Ampicillin | PMID:9660945 | Two copies of the Smad binding site (taaGTCTAGACggcaGTCTAGACgtac) are cloned into pGL3. | Backbone Marker:Promega; Backbone Size:5010; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-29 12:59:21 | 2 | ||
|
pISKP1-TIR1 Resource Report Resource Website |
RRID:Addgene_165061 | P-URA3>KlURA3>T-AgTEF1- T-PGK1-P-ACS2> SKP1>OsTIR1opt>T-URA3 | Other | Ampicillin | PMID:33594068 | Vector Backbone:pUC19; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | WT | 2026-08-29 12:59:24 | 0 | |
|
pILGFP1F5 Resource Report Resource Website |
RRID:Addgene_165064 | P-URA3>KlURA3>T-AgTEF1-P-TEF1> (BamHI)yEGFP>T-PGK1-T-URA3 | Other | Ampicillin | PMID:33594068 | Vector Backbone:pUC19; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | WT | 2026-08-29 12:59:22 | 0 | |
|
pJT11F Resource Report Resource Website |
RRID:Addgene_165062 | T-RPL3>ERG20-N127W>P-GAL1-P-GAL10>Y-FAST>T-ALD6-P-GAL2>ClLS>T-RPL41B | Other | Ampicillin | PMID:33594068 | Vector Backbone:pRS425; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | WT | 2026-08-29 12:59:22 | 0 | |
|
CMVTCRb_candidate6 Resource Report Resource Website |
RRID:Addgene_165002 | TRB | Homo sapiens | Ampicillin | PMID:33483338 | Backbone Size:9531; Vector Backbone:pLX301 (Addgene #25895); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-29 12:59:21 | 0 | ||
|
CMVTCRa_candidate6 Resource Report Resource Website |
RRID:Addgene_165001 | TRAV | Homo sapiens | Ampicillin | PMID:33483338 | Backbone Size:9531; Vector Backbone:pLX301 (Addgene #25895); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-29 12:59:21 | 0 | ||
|
CMVTCRb_candidate8 Resource Report Resource Website |
RRID:Addgene_165006 | TRB | Homo sapiens | Ampicillin | PMID:33483338 | Backbone Size:9531; Vector Backbone:pLX301 (Addgene #25895); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-29 12:59:23 | 0 | ||
|
CMVTCRa_candidate10 Resource Report Resource Website |
RRID:Addgene_165007 | TRAV | Homo sapiens | Ampicillin | PMID:33483338 | Backbone Size:9531; Vector Backbone:pLX301 (Addgene #25895); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-29 12:59:21 | 0 | ||
|
CMVTCRb_candidate7 Resource Report Resource Website |
RRID:Addgene_165004 | TRB | Homo sapiens | Ampicillin | PMID:33483338 | Backbone Size:9531; Vector Backbone:pLX301 (Addgene #25895); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-29 12:59:21 | 0 | ||
|
CMVTCRa_candidate8 Resource Report Resource Website |
RRID:Addgene_165005 | TRAV | Homo sapiens | Ampicillin | PMID:33483338 | Backbone Size:9531; Vector Backbone:pLX301 (Addgene #25895); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-29 12:59:21 | 0 | ||
|
pMasterE Resource Report Resource Website |
RRID:Addgene_165080 | OCT4 | Homo sapiens | Ampicillin | PMID:34088009 | Vector Backbone:pMaster; Vector Types:Mammalian Expression, Episomal; Bacterial Resistance:Ampicillin | 2026-08-29 12:59:22 | 0 | ||
|
pMasterK Resource Report Resource Website 1+ mentions |
RRID:Addgene_165081 | OCT4 | Homo sapiens | Ampicillin | PMID:34088009 | Please note that Addgene's NGS found that the bGH poly(A) signal between one of the oris and Lin28 is absent as compared to the annotated sequence provided by the depositor. Please note that this plasmid contains repetitive elements which are prone to recombination. Screen 3-5 small colonies to ensure the full plasmid is selected. For example, the restriction enzyme NheI can be used to check the plasmid size as shown in Addgene's Diagnostic Digest. | Vector Backbone:pMaster; Vector Types:Mammalian Expression, Episomal; Bacterial Resistance:Ampicillin | 2026-08-29 12:59:24 | 1 | |
|
CMVTCRb_candidate10 Resource Report Resource Website |
RRID:Addgene_165008 | TRB | Homo sapiens | Ampicillin | PMID:33483338 | Backbone Size:9531; Vector Backbone:pLX301 (Addgene #25895); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-29 12:59:21 | 0 | ||
|
pPBCAG-rtTAM2-2A-SOX17-GR-IH Resource Report Resource Website |
RRID:Addgene_165079 | rtTA-M2 | Synthetic | Ampicillin | PMID:33798453 | Vector Backbone:pPBCAG; Vector Types:Mammalian Expression, PiggyBac transposition; Bacterial Resistance:Ampicillin | 2026-08-29 12:59:24 | 0 | ||
|
p23-NLS-RfxCas13d-mcherry-NLS-Flag Resource Report Resource Website 1+ mentions |
RRID:Addgene_165077 | RfxCas13d | Ruminoccocus flavefaciens XPD3002 | Ampicillin | PMID:33288960 | Vector Backbone:pHAGE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 12:59:22 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.