Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:homo sapiens (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

69,655 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
MECP2 - G195S in pENTR
 
Resource Report
Resource Website 		RRID:Addgene_216597 MECP2 Homo sapiens Spectinomycin insert contains a Kozak sequence that encodes a linker for cloning into N-terminal tagging pDEST vectors Backbone Marker:GenScript; Backbone Size:2800; Vector Backbone:pCR8-GW-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin G195S 2026-08-29 01:20:08 0
MECP2 - P217L in pENTR
 
Resource Report
Resource Website 		RRID:Addgene_216599 MECP2 Homo sapiens Spectinomycin insert contains a Kozak sequence that encodes a linker for cloning into N-terminal tagging pDEST vectors Backbone Marker:GenScript; Backbone Size:2800; Vector Backbone:pCR8-GW-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin P217L 2026-08-29 01:20:10 0
pGL3-SEC61B.N-BSD.P2A.miniIAA7.3xFlag
 
Resource Report
Resource Website 		RRID:Addgene_216250 HDR template for human SEC61B Homo sapiens Ampicillin PMID:38409044 Backbone Marker:Promega; Backbone Size:2800; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, CRISPR, HDR template; Bacterial Resistance:Ampicillin 2026-08-29 01:20:09 0
pGL3-sgRANGAP.C1-CAG-Cas9-T2A-mCherry-P2A-Puro
 
Resource Report
Resource Website 		RRID:Addgene_216249 Cas9 and sgRANGAP.C1 Homo sapiens Ampicillin PMID:38409044 Backbone Marker:Promega; Backbone Size:2000; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, CRISPR, Endogenous tagging; Bacterial Resistance:Ampicillin 2026-08-29 01:20:07 0
pcDNA3.1-ARL16-His6
 
Resource Report
Resource Website 		RRID:Addgene_216484 ADP-ribosylation factor like 16 Homo sapiens Ampicillin Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:20:07 0
pET28a_Pro-IL-1β
 
Resource Report
Resource Website 		RRID:Addgene_214340 IL1B Homo sapiens Kanamycin PMID:37993712 Backbone Size:5400; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-29 01:20:09 0
pET3C-ARL16(CO)-His6
 
Resource Report
Resource Website 		RRID:Addgene_216485 ADP-ribosylation factor-like 16 Homo sapiens Ampicillin Backbone Size:4638; Vector Backbone:pET3C; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:20:09 0
pGL3-RANGAP.C-linker.miniIAA7.3xFlag.P2A.BSD
 
Resource Report
Resource Website 		RRID:Addgene_216248 HDR template for human RANGAP1 Homo sapiens Ampicillin PMID:38409044 Backbone Marker:Promega; Backbone Size:2000; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, CRISPR, TALEN, HDR template; Bacterial Resistance:Ampicillin 2026-08-29 01:20:07 0
Human V5-USP47
 
Resource Report
Resource Website 		RRID:Addgene_217626 USP47 Homo sapiens Ampicillin PMID:36749823 Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:20:08 0
OPEN HLA-A*02:01-BirA
 
Resource Report
Resource Website 		RRID:Addgene_215569 OPEN HLA-A*02:01 Homo sapiens Kanamycin PMID:37310998 Backbone Size:5242; Vector Backbone:pET24a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin Glycine 120 to Cysteine 2026-08-29 01:20:09 0
pGAL4-DBD-CEBPa-AroLITE_A
 
Resource Report
Resource Website 		RRID:Addgene_215602 CEBPa AroLITE Homo sapiens Ampicillin PMID:38969762 Vector Backbone:pGAL4-DBD-MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:20:07 0
gCH29 (crCD81-1)
 
Resource Report
Resource Website 		RRID:Addgene_217344 crCD81-1 Homo sapiens Ampicillin PMID:38760567 Please visit https://doi.org/10.1101/2023.09.18.558350 for bioRxiv preprint. Vector Backbone:pRG212; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-29 01:20:10 0
gCH132 (crCD55-4_crB2M-1_crKIT-2_crKIT-3_crCD81-1)
 
Resource Report
Resource Website 		RRID:Addgene_217341 crCD55-4 gRNA: actggtattgcggagccacgagg Homo sapiens Ampicillin PMID:38760567 Please visit https://doi.org/10.1101/2023.09.18.558350 for bioRxiv preprint. Vector Backbone:pCH49; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-29 01:20:08 0
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
 
Resource Report
Resource Website 		RRID:Addgene_217345 crCD55-4 gRNA: actggtattgcggagccacgagg Homo sapiens Ampicillin PMID:38760567 Please visit https://doi.org/10.1101/2023.09.18.558350 for bioRxiv preprint. Vector Backbone:pCH67; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-29 01:20:08 0
pPB-TetON-mEGFP-MYOD1_AroLITE-C
 
Resource Report
Resource Website 		RRID:Addgene_215619 MYOD1 AroLITE C Homo sapiens Ampicillin PMID:38969762 Vector Backbone:PB-TetON; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:20:09 0
pPB-TetON-mEGFP-MYOD1_WT
 
Resource Report
Resource Website 		RRID:Addgene_215617 MYOD1 Homo sapiens Ampicillin PMID:38969762 Vector Backbone:PB-TetON; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:20:07 0
pGAL4-DBD-HOXD4-AroPERFECT_shuffled1
 
Resource Report
Resource Website 		RRID:Addgene_215577 HOXD4 AroPERFECT shuffled1 Homo sapiens Ampicillin PMID:38969762 Vector Backbone:pGAL4-DBD-MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:20:07 0
pPB-TetON-mEGFP-NGN2_WT
 
Resource Report
Resource Website 		RRID:Addgene_215610 NGN2 Homo sapiens Ampicillin PMID:38969762 Vector Backbone:PB-TetON; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:20:07 0
TFORF2882
 
Resource Report
Resource Website 		RRID:Addgene_143653 XBP1 Homo sapiens Ampicillin PMID:36608654 NM_001079539,ENST00000611155,ENST00000344347 . The transcription factor ORF portion of this plasmid was synthesized by Genewiz. Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence. Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-29 01:20:08 0
TFORF0824
 
Resource Report
Resource Website 		RRID:Addgene_142695 LHX8 Homo sapiens Ampicillin PMID:36608654 NM_001256114,ENST00000356261 . The transcription factor ORF portion of this plasmid was synthesized by Genewiz. Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence. Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-29 01:20:08 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch