Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: Neuron-astrocyte proximity assay - Neuronal
Vector Backbone Description: Vector Backbone:pZac2.1; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29621490
Proper citation: RRID:Addgene_92283 Copy
Species: Synthetic
Genetic Insert: Neuron-astrocyte proximity assay - Astrocyte
Vector Backbone Description: Vector Backbone:pZac2.1; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29621490
Proper citation: RRID:Addgene_92281 Copy
Species: Synthetic
Genetic Insert: Dendra2
Vector Backbone Description: Backbone Size:6362; Vector Backbone:pMTB; Vector Types:Zebrafish Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22431986
Proper citation: RRID:Addgene_92401 Copy
Species: Synthetic
Genetic Insert: Dendra2
Vector Backbone Description: Backbone Size:6103; Vector Backbone:pMTB; Vector Types:Zebrafish Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_92402 Copy
Species: Synthetic
Genetic Insert: M13-TEV-C-P2A-TdTomato
Vector Backbone Description: Vector Backbone:pSyc 171 P2A vector; Vector Types:Mammalian Expression, AAV, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28650460
Proper citation: RRID:Addgene_92391 Copy
Species: Synthetic
Genetic Insert: TM-CaM-NES-TEV-N-AsLOV2-TEVseq-tTA
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28650460
Proper citation: RRID:Addgene_92392 Copy
Species: Synthetic
Genetic Insert: TM-CaM-NES-TEV-N-AsLOV2-TEVseq-tTA
Vector Backbone Description: Vector Backbone:pSyc 171 P2A vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28650460
Proper citation: RRID:Addgene_92390 Copy
Species: Synthetic
Genetic Insert: Sapphire fluorescent protein
Vector Backbone Description: Backbone Size:6295; Vector Backbone:MSCVpuro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29533508
Comments: Base vector obtained from Robert Hawley.
Proper citation: RRID:Addgene_96950 Copy
Species: Synthetic
Genetic Insert: Monomeric Infrared Fluorescent Protein
Vector Backbone Description: Backbone Size:6295; Vector Backbone:MSCVpuro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29533508
Comments: Base vector obtained from Robert Hawley.
Proper citation: RRID:Addgene_96951 Copy
Species: Synthetic
Genetic Insert: Monomeric Cerulean 3
Vector Backbone Description: Backbone Size:6295; Vector Backbone:MSCVpuro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29533508
Comments: Base vector obtained from Robert Hawley.
Proper citation: RRID:Addgene_96936 Copy
Species: Synthetic
Genetic Insert: Monomeric Orange2
Vector Backbone Description: Backbone Size:6295; Vector Backbone:MSCVpuro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29533508
Comments: Base vector obtained from Robert Hawley.
Proper citation: RRID:Addgene_96938 Copy
Species: Synthetic
Genetic Insert: Kar2-CFP-HDEL
Vector Backbone Description: Backbone Size:11752; Vector Backbone:pMDC32; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26362606
Comments: The sequences and maps of pMDC vectors can be obtained from the following website. http://www.botinst.uzh.ch/en/research/development/grossnik/vectors/MarkdGatewayVectors.html
Proper citation: RRID:Addgene_96989 Copy
Species: Synthetic
Genetic Insert: deGFP
Vector Backbone Description: Backbone Size:2538; Vector Backbone:pBEST; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_97095 Copy
Species: Synthetic
Genetic Insert: deGFP
Vector Backbone Description: Backbone Size:3191; Vector Backbone:pBEST; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_97098 Copy
Species: Synthetic
Genetic Insert: tdTomato
Vector Backbone Description: Backbone Size:6295; Vector Backbone:MSCVpuro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29533508
Comments: Base vector obtained from Robert Hawley.
Proper citation: RRID:Addgene_97079 Copy
Species: Synthetic
Genetic Insert: Actb HMEJ donor
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28524166
Comments: INSERT2:EGFP driven by EF1a promoter; INSERT3:U6-driven sgRNAs targeting Actb
Proper citation: RRID:Addgene_97308 Copy
Species: Synthetic
Genetic Insert: Actb NHEJ donor
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28524166
Comments: INSERT2:EGFP driven by EF1a promoter; INSERT3:U6-driven sgRNAs targeting Actb
Proper citation: RRID:Addgene_97310 Copy
Species: Synthetic
Genetic Insert: Actb HR donor
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:28524166
Proper citation: RRID:Addgene_97317 Copy
Species: Synthetic
Genetic Insert: Actb HMEJ donor
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:28524166
Comments: gRNA sequence: agtccgcctagaagcacttg
Proper citation: RRID:Addgene_97318 Copy
Species: Synthetic
Genetic Insert: Dbh HMEJ donor
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:28524166
Comments: gRNA sequence: agaatagcttctcacaaggt
Proper citation: RRID:Addgene_97320 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.