Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 436 showing 8701 ~ 8720 out of 30,615 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/92283

Species: Synthetic
Genetic Insert: Neuron-astrocyte proximity assay - Neuronal
Vector Backbone Description: Vector Backbone:pZac2.1; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29621490

Proper citation: RRID:Addgene_92283 Copy   


  • RRID:Addgene_92281

    This resource has 1+ mentions.

http://www.addgene.org/92281

Species: Synthetic
Genetic Insert: Neuron-astrocyte proximity assay - Astrocyte
Vector Backbone Description: Vector Backbone:pZac2.1; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29621490

Proper citation: RRID:Addgene_92281 Copy   


http://www.addgene.org/92401

Species: Synthetic
Genetic Insert: Dendra2
Vector Backbone Description: Backbone Size:6362; Vector Backbone:pMTB; Vector Types:Zebrafish Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22431986

Proper citation: RRID:Addgene_92401 Copy   


http://www.addgene.org/92402

Species: Synthetic
Genetic Insert: Dendra2
Vector Backbone Description: Backbone Size:6103; Vector Backbone:pMTB; Vector Types:Zebrafish Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_92402 Copy   


  • RRID:Addgene_92391

    This resource has 1+ mentions.

http://www.addgene.org/92391

Species: Synthetic
Genetic Insert: M13-TEV-C-P2A-TdTomato
Vector Backbone Description: Vector Backbone:pSyc 171 P2A vector; Vector Types:Mammalian Expression, AAV, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28650460

Proper citation: RRID:Addgene_92391 Copy   


http://www.addgene.org/92392

Species: Synthetic
Genetic Insert: TM-CaM-NES-TEV-N-AsLOV2-TEVseq-tTA
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28650460

Proper citation: RRID:Addgene_92392 Copy   


http://www.addgene.org/92390

Species: Synthetic
Genetic Insert: TM-CaM-NES-TEV-N-AsLOV2-TEVseq-tTA
Vector Backbone Description: Vector Backbone:pSyc 171 P2A vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28650460

Proper citation: RRID:Addgene_92390 Copy   


  • RRID:Addgene_96950

http://www.addgene.org/96950

Species: Synthetic
Genetic Insert: Sapphire fluorescent protein
Vector Backbone Description: Backbone Size:6295; Vector Backbone:MSCVpuro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29533508
Comments: Base vector obtained from Robert Hawley.

Proper citation: RRID:Addgene_96950 Copy   


  • RRID:Addgene_96951

http://www.addgene.org/96951

Species: Synthetic
Genetic Insert: Monomeric Infrared Fluorescent Protein
Vector Backbone Description: Backbone Size:6295; Vector Backbone:MSCVpuro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29533508
Comments: Base vector obtained from Robert Hawley.

Proper citation: RRID:Addgene_96951 Copy   


  • RRID:Addgene_96936

    This resource has 1+ mentions.

http://www.addgene.org/96936

Species: Synthetic
Genetic Insert: Monomeric Cerulean 3
Vector Backbone Description: Backbone Size:6295; Vector Backbone:MSCVpuro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29533508
Comments: Base vector obtained from Robert Hawley.

Proper citation: RRID:Addgene_96936 Copy   


  • RRID:Addgene_96938

http://www.addgene.org/96938

Species: Synthetic
Genetic Insert: Monomeric Orange2
Vector Backbone Description: Backbone Size:6295; Vector Backbone:MSCVpuro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29533508
Comments: Base vector obtained from Robert Hawley.

Proper citation: RRID:Addgene_96938 Copy   


  • RRID:Addgene_96989

http://www.addgene.org/96989

Species: Synthetic
Genetic Insert: Kar2-CFP-HDEL
Vector Backbone Description: Backbone Size:11752; Vector Backbone:pMDC32; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26362606
Comments: The sequences and maps of pMDC vectors can be obtained from the following website. http://www.botinst.uzh.ch/en/research/development/grossnik/vectors/MarkdGatewayVectors.html

Proper citation: RRID:Addgene_96989 Copy   


  • RRID:Addgene_97095

http://www.addgene.org/97095

Species: Synthetic
Genetic Insert: deGFP
Vector Backbone Description: Backbone Size:2538; Vector Backbone:pBEST; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_97095 Copy   


  • RRID:Addgene_97098

http://www.addgene.org/97098

Species: Synthetic
Genetic Insert: deGFP
Vector Backbone Description: Backbone Size:3191; Vector Backbone:pBEST; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_97098 Copy   


  • RRID:Addgene_97079

http://www.addgene.org/97079

Species: Synthetic
Genetic Insert: tdTomato
Vector Backbone Description: Backbone Size:6295; Vector Backbone:MSCVpuro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29533508
Comments: Base vector obtained from Robert Hawley.

Proper citation: RRID:Addgene_97079 Copy   


http://www.addgene.org/97308

Species: Synthetic
Genetic Insert: Actb HMEJ donor
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28524166
Comments: INSERT2:EGFP driven by EF1a promoter; INSERT3:U6-driven sgRNAs targeting Actb

Proper citation: RRID:Addgene_97308 Copy   


http://www.addgene.org/97310

Species: Synthetic
Genetic Insert: Actb NHEJ donor
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28524166
Comments: INSERT2:EGFP driven by EF1a promoter; INSERT3:U6-driven sgRNAs targeting Actb

Proper citation: RRID:Addgene_97310 Copy   


  • RRID:Addgene_97317

    This resource has 1+ mentions.

http://www.addgene.org/97317

Species: Synthetic
Genetic Insert: Actb HR donor
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:28524166

Proper citation: RRID:Addgene_97317 Copy   


  • RRID:Addgene_97318

http://www.addgene.org/97318

Species: Synthetic
Genetic Insert: Actb HMEJ donor
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:28524166
Comments: gRNA sequence: agtccgcctagaagcacttg

Proper citation: RRID:Addgene_97318 Copy   


  • RRID:Addgene_97320

http://www.addgene.org/97320

Species: Synthetic
Genetic Insert: Dbh HMEJ donor
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:28524166
Comments: gRNA sequence: agaatagcttctcacaaggt

Proper citation: RRID:Addgene_97320 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X