Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: BRAF
Vector Backbone Description: Backbone Marker:GenScript; Backbone Size:2800; Vector Backbone:pCR8-GW-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
Comments: insert contains a Kozak sequence that encodes a linker for cloning into N-terminal tagging pDEST vectors
Proper citation: RRID:Addgene_216609 Copy
Species: Homo sapiens
Genetic Insert: MECP2
Vector Backbone Description: Backbone Marker:GenScript; Backbone Size:2800; Vector Backbone:pCR8-GW-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
Comments: insert contains a Kozak sequence that encodes a linker for cloning into N-terminal tagging pDEST vectors
Proper citation: RRID:Addgene_216602 Copy
Species: Homo sapiens
Genetic Insert: BRAF
Vector Backbone Description: Backbone Marker:GenScript; Backbone Size:2800; Vector Backbone:pCR8-GW-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
Comments: insert contains a Kozak sequence that encodes a linker for cloning into N-terminal tagging pDEST vectors
Proper citation: RRID:Addgene_216606 Copy
Species: Homo sapiens
Genetic Insert: BRAF
Vector Backbone Description: Backbone Marker:GenScript; Backbone Size:2800; Vector Backbone:pCR8-GW-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
Comments: insert contains a Kozak sequence that encodes a linker for cloning into N-terminal tagging pDEST vectors
Proper citation: RRID:Addgene_216605 Copy
Species: Homo sapiens
Genetic Insert: EGR1 AroPATCHY3
Vector Backbone Description: Vector Backbone:pGAL4-DBD-MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38969762
Proper citation: RRID:Addgene_215595 Copy
Species: Homo sapiens
Genetic Insert: ESRRG
Vector Backbone Description: Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36608654
Comments: NM_001438,ENST00000408911 . The transcription factor ORF portion of this plasmid was synthesized by Genewiz. Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence.
Proper citation: RRID:Addgene_142978 Copy
Species: Homo sapiens
Genetic Insert: CTGAAGGAACAGACTAATTC
Vector Backbone Description: Backbone Size:8484; Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37341699
Proper citation: RRID:Addgene_207106 Copy
Species: Homo sapiens
Genetic Insert: BRAF
Vector Backbone Description: Backbone Marker:GenScript; Backbone Size:2800; Vector Backbone:pCR8-GW-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
Comments: insert contains a Kozak sequence that encodes a linker for cloning into N-terminal tagging pDEST vectors
Proper citation: RRID:Addgene_216613 Copy
Species: Homo sapiens
Genetic Insert: BRAF
Vector Backbone Description: Backbone Marker:GenScript; Backbone Size:2800; Vector Backbone:pCR8-GW-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
Comments: insert contains a Kozak sequence that encodes a linker for cloning into N-terminal tagging pDEST vectors
Proper citation: RRID:Addgene_216612 Copy
Species: Homo sapiens
Genetic Insert: CTNNB1
Vector Backbone Description: Backbone Marker:GenScript; Backbone Size:2800; Vector Backbone:pCR8-GW-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
Comments: insert contains a Kozak sequence that encodes a linker for cloning into N-terminal tagging pDEST vectors
Proper citation: RRID:Addgene_216619 Copy
Species: Homo sapiens
Genetic Insert: MBD2
Vector Backbone Description: Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36608654
Comments: NM_003927,ENST00000256429 . The transcription factor ORF portion of this plasmid was synthesized by Genewiz. Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence.
Proper citation: RRID:Addgene_144019 Copy
Species: Homo sapiens
Genetic Insert: CTNNB1
Vector Backbone Description: Backbone Marker:GenScript; Backbone Size:2800; Vector Backbone:pCR8-GW-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
Comments: insert contains a Kozak sequence that encodes a linker for cloning into N-terminal tagging pDEST vectors
Proper citation: RRID:Addgene_216623 Copy
Species: Homo sapiens
Genetic Insert: SOX21
Vector Backbone Description: Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36608654
Comments: NM_007084,ENST00000376945 . The transcription factor ORF portion of this plasmid was synthesized by Genewiz. Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence.
Proper citation: RRID:Addgene_143968 Copy
Species: Homo sapiens
Genetic Insert: CTNNB1
Vector Backbone Description: Backbone Marker:GenScript; Backbone Size:2800; Vector Backbone:pCR8-GW-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
Comments: insert contains a Kozak sequence that encodes a linker for cloning into N-terminal tagging pDEST vectors
Proper citation: RRID:Addgene_216621 Copy
Species: Homo sapiens
Genetic Insert: RUNX1T1
Vector Backbone Description: Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36608654
Comments: NM_001198679,ENST00000436581 . The transcription factor ORF portion of this plasmid was synthesized by Genewiz. Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence.
Proper citation: RRID:Addgene_142369 Copy
Species: Homo sapiens
Genetic Insert: ZNF362
Vector Backbone Description: Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36608654
Comments: NM_152493,XM_017000415,ENST00000539719,ENST00000373428 . The transcription factor ORF portion of this plasmid was synthesized by Genewiz. Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence.
Proper citation: RRID:Addgene_142387 Copy
Species: Homo sapiens
Genetic Insert: NR1I2
Vector Backbone Description: Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36608654
Comments: NM_003889,ENST00000393716,ENST00000640105 . The transcription factor ORF portion of this plasmid was synthesized by Genewiz. Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence.
Proper citation: RRID:Addgene_142668 Copy
Species: Homo sapiens
Genetic Insert: ZFPM1
Vector Backbone Description: Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36608654
Comments: NM_153813,ENST00000319555 . The transcription factor ORF portion of this plasmid was synthesized by Genewiz. Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence.
Proper citation: RRID:Addgene_144334 Copy
Species: Homo sapiens
Genetic Insert: HOXD4 YPWM(-)
Vector Backbone Description: Vector Backbone:pGAL4-DBD-MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38969762
Proper citation: RRID:Addgene_215579 Copy
Species: Homo sapiens
Genetic Insert: NGN2 AroLITE
Vector Backbone Description: Vector Backbone:PB-TetON; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38969762
Proper citation: RRID:Addgene_215612 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
