Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: mPlum
Vector Backbone Description: Vector Backbone:pGEN-mcs (ori15A); Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30301859
Proper citation: RRID:Addgene_117388 Copy
Species: Synthetic
Genetic Insert: GCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
Vector Backbone Description: Backbone Size:5352; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30626963
Proper citation: RRID:Addgene_117384 Copy
Species: Synthetic
Genetic Insert: mPlum
Vector Backbone Description: Vector Backbone:pUC18R6K; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30301859
Proper citation: RRID:Addgene_117392 Copy
Species: Synthetic
Genetic Insert: dTomato
Vector Backbone Description: Vector Backbone:pUC18R6K; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30301859
Proper citation: RRID:Addgene_117391 Copy
Species: Synthetic
Genetic Insert: sfGFP
Vector Backbone Description: Vector Backbone:pUC18; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30301859
Proper citation: RRID:Addgene_117394 Copy
Species: Synthetic
Genetic Insert: EYFP
Vector Backbone Description: Backbone Size:4751; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30626963
Proper citation: RRID:Addgene_117383 Copy
Species: Synthetic
Genetic Insert: SauCas9 sgRNA targeting TLR 2.0
Vector Backbone Description: Backbone Marker:Addgene#50920; Vector Backbone:pLKO.1-puro-U6; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36070530
Comments: Plasmid contains an IS1 prokaryotic transposable element that does not affect plasmid function.
Please visit https://www.biorxiv.org/content/10.1101/864199v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_117409 Copy
Species: Synthetic
Genetic Insert: SpyCas9 sgRNA targeting TLR 2.0
Vector Backbone Description: Backbone Marker:Addgene#50920; Vector Backbone:pLKO.1-puro-U6; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36070530
Comments: Plasmid contains an IS1 prokaryotic transposable element that does not affect plasmid function.
Please visit https://www.biorxiv.org/content/10.1101/864199v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_117406 Copy
Species: Synthetic
Genetic Insert: BpiI:tagt:UBI10:Cas9-3(intron):E9:ttgc:BpiI
Vector Backbone Description: Backbone Size:4352; Vector Backbone:pICH47811; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30625150
Comments: Cloned by Baptiste Castel . Please visit https://www.biorxiv.org/content/early/2018/09/17/419952 for bioRxiv preprint.
Proper citation: RRID:Addgene_117503 Copy
Species: Synthetic
Genetic Insert: BpiI:GCAA:UBI10:Cas9-3(intron):E9:ACTA:BpiI
Vector Backbone Description: Backbone Size:4352; Vector Backbone:pICH47742; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30625150
Comments: Cloned by Baptiste Castel . Please visit https://www.biorxiv.org/content/early/2018/09/17/419952 for bioRxiv preprint.
Proper citation: RRID:Addgene_117502 Copy
Species: Synthetic
Genetic Insert: AsCas12a gRNA targeting TLR 2.0
Vector Backbone Description: Backbone Marker:Addgene#50920; Vector Backbone:pLKO.1-puro-U6; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36070530
Comments: Plasmid contains an IS1 prokaryotic transposable element that does not affect plasmid function.
Please visit https://www.biorxiv.org/content/10.1101/864199v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_117411 Copy
Species: Synthetic
Genetic Insert: FnCas12a gRNA targeting TLR 2.0
Vector Backbone Description: Vector Backbone:pBluescript SK (+); Vector Types:; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:36070530
Comments: Please visit https://www.biorxiv.org/content/10.1101/864199v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_117412 Copy
Species: Synthetic
Genetic Insert: [35S:Sp-eCas9 1.0(pEPOR1CB0010) ] +[AtU6-26:sgRNA]
Vector Backbone Description: Vector Backbone:pICSL4723; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30811422
Comments: Please visit https://www.biorxiv.org/content/early/2018/09/20/422766 for BioRxiv preprint
Proper citation: RRID:Addgene_117597 Copy
Species: Synthetic
Genetic Insert: [35S:Sp-eCas9 1.0(pEPOR1CB0010) ] +[AtU6-26:sgRNA]
Vector Backbone Description: Vector Backbone:pICSL4723; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30811422
Comments: Please visit https://www.biorxiv.org/content/early/2018/09/20/422766 for BioRxiv preprint
Proper citation: RRID:Addgene_117594 Copy
Species: Synthetic
Genetic Insert: [35S:SpCas9-KA(pEPOR1CB0009) ] +[AtU6-26:sgRNA]
Vector Backbone Description: Vector Backbone:pICSL4723; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30811422
Comments: Please visit https://www.biorxiv.org/content/early/2018/09/20/422766 for BioRxiv preprint
Proper citation: RRID:Addgene_117593 Copy
Species: Synthetic
Genetic Insert: BpiI:ACTA:pU6-26:sgRNA-EF:t192bp:TTAC:BpiI
Vector Backbone Description: Backbone Size:4352; Vector Backbone:pICH47751; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30625150
Comments: Cloned by Laurence Tomlinson.
Primers to amplify a sgRNA:
Fw: ga GGTCTCa ATTG [x] GTTTAAGAGCTATGCTGGAA, where [x] is the 20nt spacer/target sequence (NOT including the PAM).
Rv: tgtggtctcaAGCGAAAAAAAGCACCGACTC (for polyT terminator)
tgtggtctcaAGCGACCCCAGAAATTGAAC (for 67 bp U6-26 terminator, recommanded)
tgtggtctcaAGCGTATTGGTTTATCTCATCG (for 192 bp U6-26 terminator).
The PCR amplicon is ready to clone in a Golden Gate fashion with U6-26 promoter (pICSL90002) and any Golden Gate compatible acceptor vector Level 1, using BsaI. Please visit https://www.biorxiv.org/content/early/2018/09/17/419952 for bioRxiv preprint.
Proper citation: RRID:Addgene_117518 Copy
Species: Synthetic
Genetic Insert: BpiI:ACTA:pU6-26:sgRNA:polyT:TTAC:BpiI
Vector Backbone Description: Backbone Size:4352; Vector Backbone:pICH47751; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30625150
Comments: Cloned by Laurence Tomlinson.
Primers to amplify a sgRNA:
Fw: ga GGTCTCa ATTG [x] GTTTTAGAGCTAGAAATAGC, where [x] is the 20nt spacer/target sequence (NOT including the PAM).
Rv: tgtggtctcaAGCGAAAAAAAGCACCGACTC.
The PCR amplicon is ready to clone in a Golden Gate fashion with U6-26 promoter (pICSL90002) and any Golden Gate compatible acceptor vector Level 1, using BsaI. Please visit https://www.biorxiv.org/content/early/2018/09/17/419952 for bioRxiv preprint.
Proper citation: RRID:Addgene_117517 Copy
Species: Synthetic
Genetic Insert: BsaI:AATG:Cas9_2:GCTT:BsaI
Vector Backbone Description: Backbone Size:2247; Vector Backbone:pICH41308; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:30625150
Comments: Cloned by Oleg Raitskin . Please visit https://www.biorxiv.org/content/early/2018/09/17/419952 for bioRxiv preprint.
Proper citation: RRID:Addgene_117514 Copy
Species: Synthetic
Genetic Insert: [35S:SpCas9-DE(pEPOR1CB0008) ] +[AtU6-26:sgRNA]
Vector Backbone Description: Vector Backbone:pICSL4723; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30811422
Comments: Please visit https://www.biorxiv.org/content/early/2018/09/20/422766 for BioRxiv preprint
Proper citation: RRID:Addgene_117588 Copy
Species: Synthetic
Genetic Insert: [35S:SpCas9-h(pICSL11023) ] +[AtU6-26:sgRNA]
Vector Backbone Description: Vector Backbone:pICSL4723; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30811422
Comments: Please visit https://www.biorxiv.org/content/early/2018/09/20/422766 for BioRxiv preprint
Proper citation: RRID:Addgene_117582 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.