Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:mus musculus (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

12,972 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
Venus rGBD
 
Resource Report
Resource Website 		RRID:Addgene_99015 rGBD Mus musculus Ampicillin PMID:29937389 Backbone Marker:invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:13:23 0
pLV-shMdk-334
 
Resource Report
Resource Website 		RRID:Addgene_99025 Mdk shRNA Mus musculus Ampicillin PMID:28398003 This plasmid was generated as part of the NIAAA-funded INIA consortium. Backbone Marker:MIT; Backbone Size:7649; Vector Backbone:pLL3.7; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-29 01:13:22 0
pAdCMV/V5-DEST-Y705F-STAT3-3xFlag
 
Resource Report
Resource Website 		RRID:Addgene_99261 Signal transducer and activator of transcription 3 - Y705F Mus musculus Ampicillin PMID:29351406 *E16K mutation in STAT3 Backbone Marker:Thermo Fisher; Backbone Size:34621; Vector Backbone:pAdCMV/V5-DEST; Vector Types:Adenoviral; Bacterial Resistance:Ampicillin Y705F (contains a silent mutation: nucleotide 2717 T->C already present in Addgene plasmid #8709) 2026-08-29 01:13:24 0
pAdCMV/V5-DEST-STAT3-3xFlag
 
Resource Report
Resource Website 		RRID:Addgene_99260 Signal transducer and activator of transcription 3 Mus musculus Ampicillin PMID:29351406 *E16K mutation in STAT3 Backbone Marker:Thermo Fisher; Backbone Size:34621; Vector Backbone:pAdCMV/V5-DEST; Vector Types:Adenoviral; Bacterial Resistance:Ampicillin 2026-08-29 01:13:24 0
pAdCMV/V5-DEST-S727D-STAT3-3xFlag
 
Resource Report
Resource Website 		RRID:Addgene_99263 Signal transducer and activator of transcription 3 - S727D Mus musculus Ampicillin PMID:29351406 *E16K mutation in STAT3 Backbone Marker:Thermo Fisher; Backbone Size:34621; Vector Backbone:pAdCMV/V5-DEST; Vector Types:Adenoviral; Bacterial Resistance:Ampicillin S727D 2026-08-29 01:13:24 0
pET-ZZ(1700-1751)
 
Resource Report
Resource Website 		RRID:Addgene_99334 CBP ZZ domain Mus musculus Ampicillin PMID:15476823 Backbone Marker:Novagen; Backbone Size:5443; Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:13:24 0
His6tev CBP BCHZ (1079-1751)
 
Resource Report
Resource Website 		RRID:Addgene_99341 mouse CBP BRD-ZZ domains (1079-1751) Mus musculus Ampicillin PMID:28630323 Backbone Marker:Novagen; Backbone Size:5493; Vector Backbone:pET22b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:13:25 0
His6tev CBP BCHZDeltaAL
 
Resource Report
Resource Website 		RRID:Addgene_99551 mouse CBP BRD-ZZ domains (1079-1751) DeltaAL Mus musculus Ampicillin PMID:28630323 Backbone Marker:Novagen; Backbone Size:5493; Vector Backbone:pET22b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin replaced 1557-1618 with SGGSG 2026-08-29 01:13:27 0
Pak3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_99510 Pak3 Mus musculus Ampicillin PMID:23622267 Backbone Marker:Clontech; Backbone Size:3791; Vector Backbone:pCMV- myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:13:26 1
GST-BRD (1079-1198)
 
Resource Report
Resource Website 		RRID:Addgene_99507 mouse CBP BRD (1079-1198) Mus musculus Ampicillin PMID:23831576 Backbone Marker:NEB; Backbone Size:4970; Vector Backbone:pGEX4T2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:13:26 0
CREB3L3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_99509 CREB3L3 Mus musculus Ampicillin PMID:15800215 Backbone Marker:Invitrogen; Backbone Size:5502; Vector Backbone:pcDNA3.1 V5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:13:27 1
pAAV-CMV-dSa VP64 Neurog2
 
Resource Report
Resource Website 		RRID:Addgene_99695 dCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) Mus musculus Ampicillin Please visit https://doi.org/10.1101/298620 for bioRxiv preprint. Vector Backbone:pAAV (pUC f1); Vector Types:AAV, CRISPR; Bacterial Resistance:Ampicillin dead Cas9 2026-08-29 01:13:29 0
pRosa26-4xInsulator (JP6)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_99627 Gt(Rosa)26Sor Mus musculus Ampicillin PMID:28802047 Vector Backbone:pBlueScript KS II; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin 2026-08-29 01:13:27 1
AAV-KrasWT/sgKras/Cre
 
Resource Report
Resource Website 		RRID:Addgene_99848 Kras Mus musculus Ampicillin PMID:29233960 https://benchling.com/s/seq-GnrunufwzMMMiUzJgwLR Backbone Size:5958; Vector Backbone:388-MCS AAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin AvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutations (GACTGAGTATAAACTTGTGGTGG>GACTGAGTATAAACTAGTAGTCG), Barcode = (AGGCAAGAGCGCCTTGACGATA>AGGCAAGTCGGCACTGACGATA), BsiWI site (CGTGCG>CGTACG) 2026-08-29 01:13:29 0
pCDH-CMV-Tmeff2-3xFlag-EF1-nlsCopGFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_99729 Tmeff2 Mus musculus Ampicillin PMID:28336932 Vector Backbone:pCDH-CMV-MCS-EF1-nlsCopGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:13:28 1
iChr2-Notch Mosaic (SO250)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_99752 HIs-H2B-Cherry, H2B-EGFP-V5, HA-H2B-Cerulean, DN-Maml1, NICD-PEST Mus musculus Ampicillin PMID:28802047 Please note that several discrepancies were found between Addgene's quality control and the depositor's sequence. The depositor noted that these discrepancies do NOT affect plasmid function. Vector Backbone:pBlueScript KS; Vector Types:Mammalian Expression, Mouse Targeting, Cre/Lox; Bacterial Resistance:Ampicillin 2026-08-29 01:13:28 2
AAV-KrasG12C/sgKras/Cre
 
Resource Report
Resource Website 		RRID:Addgene_99850 Kras Mus musculus Ampicillin PMID:29233960 https://benchling.com/s/seq-Fo9yObwqPPQCG479P7Ll Backbone Size:5958; Vector Backbone:388-MCS AAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin AvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutations (GACTGAGTATAAACTTGTGGTGG>GACTGAGTATAAACTAGTAGTCG), G12C mutation (GGT>TGT), Barcode = (AGGCAAGAGCGCCTTGACGATA>CGGAAAGTCGGCCCTAACAATA), BsiWI site (CGTGCG>CGTACG) 2026-08-29 01:13:30 0
AAV-KrasG12R/sgKras/Cre
 
Resource Report
Resource Website 		RRID:Addgene_99852 Kras Mus musculus Ampicillin PMID:29233960 https://benchling.com/s/seq-ZwWNXX7tP0bisKZNlE3U Backbone Size:5958; Vector Backbone:388-MCS AAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin AvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutations (GACTGAGTATAAACTTGTGGTGG>GACTGAGTATAAACTAGTAGTCG), G12R mutation (GGT>CGT), Barcode = (AGGCAAGAGCGCCTTGACGATA>AGGTAAGTCAGCCCTGACGATT), BsiWI site (CGTGCG>CGTACG) 2026-08-29 01:13:29 0
AAV-KrasG12V/sgKras/Cre
 
Resource Report
Resource Website 		RRID:Addgene_99854 Kras Mus musculus Ampicillin PMID:29233960 https://benchling.com/s/seq-VYuSAajucKlD3iRxltcy Backbone Size:5958; Vector Backbone:388-MCS AAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin AvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutations (GACTGAGTATAAACTTGTGGTGG>GACTGAGTATAAACTAGTAGTCG), G12V mutation (GGT>GTT), Barcode = (AGGCAAGAGCGCCTTGACGATA>CGGGAAATCGGCCCTTACTATT), BsiWI site (CGTGCG>CGTACG) 2026-08-29 01:13:29 0
AAV-KrasG12S/sgKras/Cre
 
Resource Report
Resource Website 		RRID:Addgene_99853 Kras Mus musculus Ampicillin PMID:29233960 https://benchling.com/s/seq-atBNRmhI5tEHkQKLBbHp Backbone Size:5958; Vector Backbone:388-MCS AAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin AvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutations (GACTGAGTATAAACTTGTGGTGG>GACTGAGTATAAACTAGTAGTCG), G12S mutation (GGT>AGT), Barcode = (AGGCAAGAGCGCCTTGACGATA>TGGCAAGTCCGCCCTAACGATC), BsiWI site (CGTGCG>CGTACG) 2026-08-29 01:13:30 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch