Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 438 showing 8741 ~ 8760 out of 69,655 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_215106

http://www.addgene.org/215106

Species: Homo sapiens
Genetic Insert: CDKN1A
Vector Backbone Description: Vector Backbone:pcDNA 3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38458201

Proper citation: RRID:Addgene_215106 Copy   


  • RRID:Addgene_215108

http://www.addgene.org/215108

Species: Homo sapiens
Genetic Insert: CDKN1A
Vector Backbone Description: Vector Backbone:pcDNA 3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38458201

Proper citation: RRID:Addgene_215108 Copy   


  • RRID:Addgene_215084

http://www.addgene.org/215084

Species: Homo sapiens
Genetic Insert: CCND1
Vector Backbone Description: Vector Backbone:pBABE; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38458201

Proper citation: RRID:Addgene_215084 Copy   


  • RRID:Addgene_215116

http://www.addgene.org/215116

Species: Homo sapiens
Genetic Insert: CCND3
Vector Backbone Description: Vector Backbone:pcDNA 3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38458201

Proper citation: RRID:Addgene_215116 Copy   


http://www.addgene.org/215638

Species: Homo sapiens
Genetic Insert: CEBPa(N) FUSNxs
Vector Backbone Description: Vector Backbone:pGAL4-DBD-MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38969762

Proper citation: RRID:Addgene_215638 Copy   


  • RRID:Addgene_215111

http://www.addgene.org/215111

Species: Homo sapiens
Genetic Insert: CDKN1A
Vector Backbone Description: Vector Backbone:pTRIPZ; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38458201

Proper citation: RRID:Addgene_215111 Copy   


  • RRID:Addgene_215110

http://www.addgene.org/215110

Species: Homo sapiens
Genetic Insert: CDKN1A
Vector Backbone Description: Vector Backbone:pTRIPZ; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38458201

Proper citation: RRID:Addgene_215110 Copy   


http://www.addgene.org/215079

Species: Homo sapiens
Genetic Insert: CDKN1A
Vector Backbone Description: Vector Backbone:pBABE; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38458201

Proper citation: RRID:Addgene_215079 Copy   


  • RRID:Addgene_215112

http://www.addgene.org/215112

Species: Homo sapiens
Genetic Insert: CDKN1A
Vector Backbone Description: Vector Backbone:pTRIPZ; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38458201

Proper citation: RRID:Addgene_215112 Copy   


http://www.addgene.org/215090

Species: Homo sapiens
Genetic Insert: CCND1
Vector Backbone Description: Vector Backbone:pcDNA 3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38458201

Proper citation: RRID:Addgene_215090 Copy   


  • RRID:Addgene_215091

http://www.addgene.org/215091

Species: Homo sapiens
Genetic Insert: CDT2
Vector Backbone Description: Vector Backbone:pcDNA 3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38458201

Proper citation: RRID:Addgene_215091 Copy   


  • RRID:Addgene_215129

http://www.addgene.org/215129

Species: Homo sapiens
Genetic Insert: FEN1
Vector Backbone Description: Backbone Marker:Takara Bio; Vector Backbone:pRetroQ-C1; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38458201

Proper citation: RRID:Addgene_215129 Copy   


  • RRID:Addgene_215089

http://www.addgene.org/215089

Species: Homo sapiens
Genetic Insert: CCND1
Vector Backbone Description: Vector Backbone:pcDNA 3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38458201

Proper citation: RRID:Addgene_215089 Copy   


http://www.addgene.org/215088

Species: Homo sapiens
Genetic Insert: CCND1
Vector Backbone Description: Vector Backbone:pcDNA 3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38458201

Proper citation: RRID:Addgene_215088 Copy   


  • RRID:Addgene_215121

http://www.addgene.org/215121

Species: Homo sapiens
Genetic Insert: MSH2
Vector Backbone Description: Backbone Marker:Takara Bio; Vector Backbone:pRetroQ-C1; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38458201

Proper citation: RRID:Addgene_215121 Copy   


  • RRID:Addgene_215123

http://www.addgene.org/215123

Species: Homo sapiens
Genetic Insert: MSH6
Vector Backbone Description: Backbone Marker:Takara Bio; Vector Backbone:pRetroQ-C1; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38458201

Proper citation: RRID:Addgene_215123 Copy   


  • RRID:Addgene_215125

http://www.addgene.org/215125

Species: Homo sapiens
Genetic Insert: EXO1B
Vector Backbone Description: Backbone Marker:Takara Bio; Vector Backbone:pRetroQ-N1; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38458201

Proper citation: RRID:Addgene_215125 Copy   


http://www.addgene.org/207091

Species: Homo sapiens
Genetic Insert: GGGGAGCAGATGGACCCTAC
Vector Backbone Description: Backbone Size:8484; Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37341699

Proper citation: RRID:Addgene_207091 Copy   


  • RRID:Addgene_215049

http://www.addgene.org/215049

Species: Homo sapiens
Genetic Insert: CCNB1
Vector Backbone Description: Vector Backbone:pBABE; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38458201

Proper citation: RRID:Addgene_215049 Copy   


http://www.addgene.org/200481

Species: Homo sapiens
Genetic Insert: CXCR4-E2(38)
Vector Backbone Description: Backbone Marker:addgene; Backbone Size:8648; Vector Backbone:pKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37922452

Proper citation: RRID:Addgene_200481 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X