Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Backbone Marker:Partially Addgene; Backbone Size:3604; Vector Backbone:Constructed from MoClo Yeast Toolkit (Kit # 1000000061) and our own yeast origin, also available as Addgene plasmid 125059; Vector Types:Yeast Expression, Kluyveromyces marxianus; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33176787
Proper citation: RRID:Addgene_160004 Copy
Vector Backbone Description: Backbone Marker:Partially Addgene; Backbone Size:3656; Vector Backbone:Constructed from MoClo Yeast Toolkit (Kit # 1000000061) and our own yeast origin, also available as Addgene plasmid 125059; Vector Types:Yeast Expression, Kluyveromyces marxianus; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33176787
Proper citation: RRID:Addgene_160005 Copy
Vector Backbone Description: Backbone Marker:Partially Addgene; Backbone Size:3932; Vector Backbone:Constructed from MoClo Yeast Toolkit (Kit # 1000000061) and our own yeast origin, also available as Addgene plasmid 125059; Vector Types:Yeast Expression, Kluyveromyces marxianus; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33176787
Proper citation: RRID:Addgene_160007 Copy
Vector Backbone Description: Backbone Marker:Partially Addgene; Backbone Size:4904; Vector Backbone:Constructed from MoClo Yeast Toolkit (Kit # 1000000061) and own yeast homology arms (Addgene plasmids 125030 and 125063); Vector Types:Yeast Expression, Kluyveromyces marxianus; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33176787
Proper citation: RRID:Addgene_160142 Copy
Vector Backbone Description: Backbone Marker:Partially Addgene; Backbone Size:5640; Vector Backbone:Constructed from MoClo Yeast Toolkit (Kit # 1000000061) and own yeast homology arms (Addgene plasmids 125032 and 125065); Vector Types:Yeast Expression, Kluyveromyces marxianus; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33176787
Proper citation: RRID:Addgene_160176 Copy
Vector Backbone Description: Vector Backbone:pRSF; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32955754
Proper citation: RRID:Addgene_160178 Copy
Vector Backbone Description: Vector Backbone:pRSF; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32955754
Proper citation: RRID:Addgene_160179 Copy
Vector Backbone Description: Backbone Marker:Partially Addgene; Backbone Size:5129; Vector Backbone:Constructed from MoClo Yeast Toolkit (Kit # 1000000061) and own yeast homology arms (Addgene plasmids 125033 and 125066); Vector Types:Yeast Expression, Kluyveromyces marxianus; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33176787
Proper citation: RRID:Addgene_160215 Copy
Vector Backbone Description: Backbone Marker:Partially Addgene; Backbone Size:5336; Vector Backbone:Constructed from MoClo Yeast Toolkit (Kit # 1000000061) and own yeast homology arms (Addgene plasmids 125032 and 125065); Vector Types:Yeast Expression, Kluyveromyces marxianus; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33176787
Proper citation: RRID:Addgene_160207 Copy
Vector Backbone Description: Backbone Marker:Dianne Duncan; Backbone Size:1961; Vector Backbone:pXZ13lacZalpha; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Kanamycin
Comments: Modification of pXZ13lacZalpha construct to exchange Kanamycin gene for original Ampicillin gene. This improves upon the cloning efficiency of the original pXZ13 vector (reference below) in three ways: 1) The distance between the Esp3I sites is increased to increase cutting efficiency, 2) lacZalpha complementation is introduced to allow for blue/white screening of recombinants, and 3) Kanamycin selection removes 3 of the 4 original parental plasmids from forming colonies in the final plating.
Original vector reference:
Zhang X, Koolhaas WH, Schnorrer F. A Versatile Two-Step CRISPR- and RMCE-Based Strategy for Efficient Genome Engineering in Drosophila. G3 (Bethesda). 2014 Oct 15;4(12):2409-18
Proper citation: RRID:Addgene_160230 Copy
Vector Backbone Description: Vector Backbone:pRSF; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32955754
Proper citation: RRID:Addgene_160185 Copy
Species: Mus musculus
Genetic Insert: Fbxw7 alpha R505C
Vector Backbone Description: Vector Backbone:pENTR1A backbone; Vector Types:Mammalian Expression, Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32371478
Proper citation: RRID:Addgene_160103 Copy
Species: Mus musculus
Genetic Insert: Irf1
Vector Backbone Description: Backbone Size:3811; Vector Backbone:pDONR221 backbone; Vector Types:Mammalian Expression, Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32371478
Proper citation: RRID:Addgene_160097 Copy
Species: Mus musculus
Genetic Insert: Mavs
Vector Backbone Description: Vector Backbone:pENTR1A backbone; Vector Types:Mammalian Expression, Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32371478
Proper citation: RRID:Addgene_160099 Copy
Species: Synthetic
Genetic Insert: SpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
Vector Backbone Description: Vector Backbone:DR274 (Addgene plasmid #42250); Vector Types:in vitro transcription of sgRNA from T7 promoter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33547443
Proper citation: RRID:Addgene_160136 Copy
Species: Synthetic
Genetic Insert: SpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
Vector Backbone Description: Vector Backbone:DR274 (Addgene plasmid #42250); Vector Types:in vitro transcription of sgRNA from T7 promoter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33547443
Proper citation: RRID:Addgene_160137 Copy
Species: Synthetic
Genetic Insert: AsCas12a crRNA with spacer #3 (spacer=CTGATGGTCCATGTCTGTTACTC)
Vector Backbone Description: Vector Backbone:DR274 (Addgene plasmid #42250); Vector Types:in vitro transcription of sgRNA from T7 promoter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33547443
Proper citation: RRID:Addgene_160138 Copy
Species: Homo sapiens
Genetic Insert: COL4A1
Vector Backbone Description: Backbone Marker:Clonetech; Vector Backbone:EGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32554938
Comments: Please note: Plasmid contains a T824P mutation in the insert (lies within the Mature Domain). This variant is not known to affect plasmid function.
Proper citation: RRID:Addgene_160317 Copy
Vector Backbone Description: Vector Backbone:pRSF; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32955754
Proper citation: RRID:Addgene_160263 Copy
Vector Backbone Description: Backbone Marker:Partially Addgene; Backbone Size:3445; Vector Backbone:Constructed from MoClo Yeast Toolkit (Kit # 1000000061) and own yeast ARS (Addgene plasmid 125062); Vector Types:Yeast Expression, Kluyveromyces marxianus; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33176787
Proper citation: RRID:Addgene_160339 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
