Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: CEBPa
Vector Backbone Description: Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38969762
Proper citation: RRID:Addgene_215613 Copy
Species: Homo sapiens
Genetic Insert: CEBPa AroPERFECT IS10
Vector Backbone Description: Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38969762
Proper citation: RRID:Addgene_215616 Copy
Species: Homo sapiens
Genetic Insert: CEBPa AroPERFECT IS15
Vector Backbone Description: Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38969762
Proper citation: RRID:Addgene_215615 Copy
Species: Homo sapiens
Genetic Insert: CCNF
Vector Backbone Description: Vector Backbone:pBABE; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38458201
Proper citation: RRID:Addgene_215054 Copy
Species: Homo sapiens
Genetic Insert: CCNE1
Vector Backbone Description: Vector Backbone:pBABE; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38458201
Proper citation: RRID:Addgene_215053 Copy
Species: Homo sapiens
Genetic Insert: human cannabinoid 2 receptor
Vector Backbone Description: Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38679329
Proper citation: RRID:Addgene_179322 Copy
Species: Homo sapiens
Genetic Insert: min-ICAM2 promoter
Vector Backbone Description: Vector Backbone:p5E-MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:41230856
Comments: Please visit https://doi.org/10.1101/2024.07.13.603267 for bioRxiv preprint.
Proper citation: RRID:Addgene_224480 Copy
Species: Homo sapiens
Genetic Insert: EFS promoter
Vector Backbone Description: Vector Backbone:pDONRP4-P1r; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:41230856
Comments: Please visit https://doi.org/10.1101/2024.07.13.603267 for bioRxiv preprint.
Proper citation: RRID:Addgene_224474 Copy
Species: Homo sapiens
Genetic Insert: ICAM2 promoter
Vector Backbone Description: Vector Backbone:p5E-MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:41230856
Comments: Please visit https://doi.org/10.1101/2024.07.13.603267 for bioRxiv preprint.
Proper citation: RRID:Addgene_224479 Copy
Species: Homo sapiens
Genetic Insert: human DHFR-HiBiT and IRES-Lyt-2
Vector Backbone Description: Backbone Marker:Prof. G. Nolan, Stanford University, Stanford, CA; Backbone Size:6352; Vector Backbone:pBMN; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37875111
Comments: The human DHFR-HiBiT fusion protein was constructed to have the HiBiT tag (VSGWRLFKKIS) sequence (Schwinn, MK et al. (2018) ACS Chem. Biol. 13(2): 467–474) located at the C-terminus of DHFR. The human DHFR-HiBiT construct was synthesized (Bio Basic) and cloned into the retroviral vector pBMN IRES-Lyt-2 (G. Nolan, Stanford University, Stanford, CA), which expresses the coding region of mouse CD8a (Lyt-2), using the restriction sites BamH1 / Not1. All constructs were sequenced to validate authenticity. BamH1- GCCACC-ATG-DHFR-HiBiT-Stop –Not1
Proper citation: RRID:Addgene_179731 Copy
Species: Homo sapiens
Genetic Insert: SOX2-3xHA-P2A-tagBFP
Vector Backbone Description: Backbone Size:8691; Vector Backbone:pAAVS1; Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37738673
Comments: Plasmid backbone was modified from Addgene Plasmid #73497 to insert the SOX2-3xHA-P2A-tagBFP cassette. sgRNA T2 target sequence (ggggccactagggacaggattgg) was cloned from Addgene Plasmid #72833 into the SspI cutsite in order to induce plasmid linearization inside the cell. Use this construct together with Addgene Plasmid #72833 to induce AAVS1 HDR integration.
Proper citation: RRID:Addgene_163701 Copy
Species: Homo sapiens
Genetic Insert: 2xCBX7CD_W35A-IFP2.0C
Vector Backbone Description: Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38554702
Proper citation: RRID:Addgene_215755 Copy
Species: Homo sapiens
Genetic Insert: CENP-E
Vector Backbone Description: Backbone Marker:Thermofisher-invitrogen; Backbone Size:4776; Vector Backbone:pFastbac 1; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35259950
Proper citation: RRID:Addgene_180484 Copy
Species: Homo sapiens
Genetic Insert: gRNA_SRR124.5
Vector Backbone Description: Backbone Size:4916; Vector Backbone:gRNA_CloningVector_tagBFP; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37738673
Comments: gRNA_CloningVector_tagBFP (Addgene Plasmid #163747) was modified to insert the target sequence upstream of the SRR124 SOX2 enhancer (GACTACTACCTGGCATAACC). Use this gRNA plasmid together with Addgene Plasmid #163754 to knock-out SRR124 and SRR134 enhancers from human cells.
Proper citation: RRID:Addgene_163753 Copy
Species: Homo sapiens
Genetic Insert: VAP-B
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherryC1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29858488
Proper citation: RRID:Addgene_226409 Copy
Species: Homo sapiens
Genetic Insert: VAP-A
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherryC1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29858488
Proper citation: RRID:Addgene_226407 Copy
Species: Homo sapiens
Genetic Insert: Htt103QdeltaP141-170
Vector Backbone Description: Backbone Size:6049; Vector Backbone:pRS416; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_224880 Copy
Species: Homo sapiens
Genetic Insert: trak1
Vector Backbone Description: Backbone Marker:Agilent; Backbone Size:4333; Vector Backbone:pCMV-Tag3A-myc vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24995978
Proper citation: RRID:Addgene_225204 Copy
Species: Homo sapiens
Genetic Insert: GNB1L
Vector Backbone Description: Vector Backbone:pLenti-CMV-Puro; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37541219
Proper citation: RRID:Addgene_224381 Copy
Species: Homo sapiens
Genetic Insert: Htt103QdeltaP125-160
Vector Backbone Description: Backbone Size:6070; Vector Backbone:pRS416; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_224883 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
