Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: FRT-kan-FRT
Vector Backbone Description: Backbone Marker:M. Koob (University of Wisconsin, Madison); Vector Backbone:pANTSγ; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:10829079
Comments: This is a template plasmids for frt-flanked kan cassette. The kan cassette originally came from pCP15.
pKD3 and pKD4 are identical except for the region between the FRT sites, so they create an identical scar that has stop codons in all six reading frames. As drawn in the map, this scar has an idealized ribosome binding site and start codon for downstream (rightward) gene expression.
Proper citation: RRID:Addgene_45605 Copy
Vector Backbone Description: Backbone Marker:Stratagene (Agilent Tech); Backbone Size:2864; Vector Backbone:pBluescript KS(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:35416085
Proper citation: RRID:Addgene_187879 Copy
Species: Synthetic
Genetic Insert: Actb HR donor
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:28524166
Proper citation: RRID:Addgene_97317 Copy
Species: Synthetic
Genetic Insert: Actb HMEJ donor
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:28524166
Comments: gRNA sequence: agtccgcctagaagcacttg
Proper citation: RRID:Addgene_97318 Copy
Species: Synthetic
Genetic Insert: Dbh HMEJ donor
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:28524166
Comments: gRNA sequence: agaatagcttctcacaaggt
Proper citation: RRID:Addgene_97320 Copy
Species: Schmidtea mediterranea
Genetic Insert: CRELD in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27612384
Comments: Cloning primers: F-AAAAATTGTGCCCATCTTCG, R-TGATTCCATCCTTCAGCACA
Proper citation: RRID:Addgene_99092 Copy
Species: Schmidtea mediterranea
Genetic Insert: sFRP1 (secreted frizzled related protein 1) in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:23297191
Comments: Cloning primers: F-AAACACTCAATGCCATGTCG, R-GTTGTCGCTGTCGATTTGTG
Proper citation: RRID:Addgene_99071 Copy
Species: Schmidtea mediterranea
Genetic Insert: Smedwi-1 in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:23297191
Comments: Cloning primers: F-CGTTCCTAAAGGCACAGCTC, R-TTGGATTAGCCCCATCTTTG
Proper citation: RRID:Addgene_99074 Copy
Species: Schmidtea mediterranea
Genetic Insert: Wnt1 (also known as WntP-1) in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:23297191
Comments: Cloning primers: F-AATCATCGCTGGAACTGTCC, R-TGTGGCAAATTTTGGTCGTA
Proper citation: RRID:Addgene_99073 Copy
Species: Schmidtea mediterranea
Genetic Insert: Activin (also known as activin 2) in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:23297191
Comments: Cloning primers: F-GGCCTTTGAAAGAACAGTGG, R-CTTCCTCGAGCGAAATTCAG
Proper citation: RRID:Addgene_99075 Copy
Species: Schmidtea mediterranea
Genetic Insert: Smad2/3 in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:23297191
Comments: Cloning primers: F-CATGGAAACAAGCATTGTGG, R-GGTGGGATCTTGCAAACTGT
Proper citation: RRID:Addgene_99078 Copy
Species: Schmidtea mediterranea
Genetic Insert: Ras-related (also known as h.18.4a) in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:23297191
Comments: Cloning primers: F-TGTGCGCTATCGTCAAAAAG, R-TTGAGATTACGAAGTCGACGAA
Proper citation: RRID:Addgene_99079 Copy
Species: Schmidtea mediterranea
Genetic Insert: Cyp1A1 (also known as h.49.4f) in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:23297191
Comments: Cloning primers: F-TTGAAATTGGAGCGAAAATTAAA, R-GGGGAAATTCTTGAACCCTTC
Note: The Cyp1A1 insert contains several mismatches compared to AY067980.1. The depositor has confirmed this does not impact plasmid function.
Proper citation: RRID:Addgene_99081 Copy
Species: Other
Genetic Insert: eyes absent (eya)
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:23297191
Proper citation: RRID:Addgene_99085 Copy
Species: Other
Genetic Insert: prohormone convertase 2 (PC2)
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:23297191
Comments: Cloning primers: F-TCGTTGCACACCTGTACCAT, R-CACTCCAACACCACAAATGC
Proper citation: RRID:Addgene_99087 Copy
Species: Schmidtea mediterranea
Genetic Insert: soxB (also known as soxB1-1) in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:23297191
Comments: Cloning primers: F-TACTCATCCGCCCTTTCATC, R-CCGATCAATGTCTTCGGACT
Proper citation: RRID:Addgene_99086 Copy
Species: Schmidtea mediterranea
Genetic Insert: SoxB2-2 in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27612384
Comments: Cloning primers: F-CGGTTACAGCGATGAAGACA, R-GAGAGTGACGGCAGAGTTCC
Proper citation: RRID:Addgene_99088 Copy
Species: Schmidtea mediterranea
Genetic Insert: Hesl-3 (hes-like) in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27612384
Comments: Cloning primers: F-GGCAGAGCTCAAAGAATTGG, R-AACGGCCAGCTTTAGGATTT
Proper citation: RRID:Addgene_99090 Copy
Species: Schmidtea mediterranea
Genetic Insert: follistatin in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:23297191
Comments: Cloning primers: F-TATGTCCGGTCGGAGAGTTT, R-GAGGTGGGGCATTTGATACA
Proper citation: RRID:Addgene_99066 Copy
Species: Schmidtea mediterranea
Genetic Insert: LDLRR-2 in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27612384
Comments: Cloning primers: F-GCCCAGACAAAGAAGATGGA, R-TGTTGCACAGCATTCGTTTT
Note: the LDLRR-2 insert has a 15 base pair deletion compared to JX010572.1. The depositor has confirmed this does not affect plasmid function.
Proper citation: RRID:Addgene_99094 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
