Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Other
Genetic Insert: N-WASP
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4735; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:11584276
Comments: Original cDNA was a gift from Dr. Hiroaki Miki
Proper citation: RRID:Addgene_47406 Copy
Species: Homo sapiens
Genetic Insert: Glucocorticoid receptor
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_47504 Copy
Species: Mus musculus
Genetic Insert: Jun
Vector Backbone Description: Backbone Size:4300; Vector Backbone:pCMV-Tag2A; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21196933
Proper citation: RRID:Addgene_47443 Copy
Species: Synthetic
Genetic Insert: Gene Expression Reporter Construct
Vector Backbone Description: Backbone Marker:DNA2.0; Backbone Size:2628; Vector Backbone:pJ251; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_47441 Copy
Species: Homo sapiens
Genetic Insert: Clavesin1
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4324; Vector Backbone:pCMV-Tag2B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19651769
Proper citation: RRID:Addgene_47430 Copy
Species: Homo sapiens
Genetic Insert: intersectin long
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:11584276
Proper citation: RRID:Addgene_47395 Copy
Genetic Insert: HIV Integrase
Vector Backbone Description: Vector Backbone:pET29a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23691126
Comments: The depositing lab recommends bacteria strain Rosetta (DE3)pLysS for protein expression.
Please contact [email protected] for additional information about this plasmid.
Proper citation: RRID:Addgene_48683 Copy
Genetic Insert: PFV Integrase
Vector Backbone Description: Vector Backbone:pET29a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23691126
Comments: The depositing lab recommends bacteria strain Rosetta (DE3)pLysS for protein expression.
Please contact [email protected] for additional information about this plasmid.
Proper citation: RRID:Addgene_48682 Copy
Species: Synthetic
Genetic Insert: sgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR-BluntII-TOPO; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24076762
Proper citation: RRID:Addgene_48672 Copy
Species: Synthetic
Genetic Insert: TD prototspacer A/PAM with reporter EYFP
Vector Backbone Description: Vector Backbone:pSC101-kan; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24076762
Proper citation: RRID:Addgene_48666 Copy
Species: Synthetic
Genetic Insert: NM prototspacer A/PAM with reporter EYFP
Vector Backbone Description: Vector Backbone:pSC101-kan; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24076762
Proper citation: RRID:Addgene_48664 Copy
Species: Synthetic
Genetic Insert: TD prototspacer B/PAM with reporter EYFP
Vector Backbone Description: Vector Backbone:pSC101-kan; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24076762
Proper citation: RRID:Addgene_48663 Copy
Species: Synthetic
Genetic Insert: SP/NM prototspacer B/PAM with reporter EYFP
Vector Backbone Description: Vector Backbone:pSC101-kan; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24076762
Proper citation: RRID:Addgene_48661 Copy
Species: Homo sapiens
Genetic Insert: AQP9
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17346701
Proper citation: RRID:Addgene_48808 Copy
Genetic Insert: sfGFP and luxI
Vector Backbone Description: Vector Backbone:pZ vector; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22178928
Comments: * The presence of glucose will reduce the amount of expression from the Lux promoter driving GFP and other genes. Omitting the glucose could potentially make the cell overburdened.
Proper citation: RRID:Addgene_48887 Copy
Genetic Insert: Sh ble
Vector Backbone Description: Backbone Marker:Life Technologies (Invitrogen); Backbone Size:2500; Vector Backbone:pDONR221; Vector Types:Gateway attB1 & attB2; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19432966
Comments: Please note that Addgene's sequencing results found a few differences when compared to the full plasmid sequence provided by the depositing laboratory. According to the depositing laboratory, these differences are not a concern for the function of the plasmid.
Proper citation: RRID:Addgene_48995 Copy
Genetic Insert: aminoglycoside 3' phosphotransferase
Vector Backbone Description: Backbone Marker:Life Technologies (Invitrogen); Backbone Size:2500; Vector Backbone:pDONR221; Vector Types:Gateway attB1 & attB2; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19432966
Comments: Please note that Addgene's sequencing results found a few differences when compared to the full plasmid sequence provided by the depositing laboratory. According to the depositing laboratory, these differences are not a concern for the function of the plasmid.
Proper citation: RRID:Addgene_48993 Copy
Species: Other
Genetic Insert: hygromycin phosphotransferase
Vector Backbone Description: Backbone Marker:Dankort Lab; Vector Backbone:pBEG R2+xL3 (Addgene plasmid 48952); Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24146852
Proper citation: RRID:Addgene_48985 Copy
Species: Other
Genetic Insert: puromycin resistance
Vector Backbone Description: Backbone Marker:Dankort Lab; Vector Backbone:pBEG R2+xL3 (Addgene plasmid 48952); Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24146852
Comments: Please note that Addgene's sequencing results identified a few sequencing differences when compared to the full plasmid sequence provided by the depositing laboratory. According to the depositing lab, these differences are not a concern for the function of the plasmid.
Proper citation: RRID:Addgene_48987 Copy
Genetic Insert: blasticidin-S deaminase
Vector Backbone Description: Backbone Marker:Dankort Lab; Vector Backbone:pBEG R2+xL3 (Addgene plasmid 48952); Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24146852
Proper citation: RRID:Addgene_48982 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
