Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 44 showing 861 ~ 880 out of 177,820 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_35910

http://www.addgene.org/35910

Species: Homo sapiens
Genetic Insert: Wnt4
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7711; Vector Backbone:pcDNA3.2/V5-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22784633

Proper citation: RRID:Addgene_35910 Copy   


  • RRID:Addgene_35876

http://www.addgene.org/35876

Species: Homo sapiens
Genetic Insert: Wnt6
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22784633

Proper citation: RRID:Addgene_35876 Copy   


  • RRID:Addgene_35875

    This resource has 1+ mentions.

http://www.addgene.org/35875

Species: Homo sapiens
Genetic Insert: Wnt5B
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22784633

Proper citation: RRID:Addgene_35875 Copy   


  • RRID:Addgene_35914

    This resource has 1+ mentions.

http://www.addgene.org/35914

Species: Homo sapiens
Genetic Insert: Wnt7A
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7711; Vector Backbone:pcDNA3.2/V5-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22784633

Proper citation: RRID:Addgene_35914 Copy   


  • RRID:Addgene_35913

    This resource has 1+ mentions.

http://www.addgene.org/35913

Species: Homo sapiens
Genetic Insert: Wnt6
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7711; Vector Backbone:pcDNA3.2/V5-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22784633

Proper citation: RRID:Addgene_35913 Copy   


  • RRID:Addgene_35912

http://www.addgene.org/35912

Species: Homo sapiens
Genetic Insert: Wnt5B
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7711; Vector Backbone:pcDNA3.2/V5-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22784633

Proper citation: RRID:Addgene_35912 Copy   


  • RRID:Addgene_35919

http://www.addgene.org/35919

Species: Homo sapiens
Genetic Insert: Wnt9B
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7711; Vector Backbone:pcDNA3.2/V5-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22784633

Proper citation: RRID:Addgene_35919 Copy   


  • RRID:Addgene_35869

http://www.addgene.org/35869

Species: Homo sapiens
Genetic Insert: Wnt2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22784633

Proper citation: RRID:Addgene_35869 Copy   


  • RRID:Addgene_35901

http://www.addgene.org/35901

Species: Homo sapiens
Genetic Insert: Wnt9B
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR/D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22784633

Proper citation: RRID:Addgene_35901 Copy   


  • RRID:Addgene_35907

http://www.addgene.org/35907

Species: Homo sapiens
Genetic Insert: Wnt2B2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7711; Vector Backbone:pcDNA3.2/V5-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22784633

Proper citation: RRID:Addgene_35907 Copy   


  • RRID:Addgene_35906

http://www.addgene.org/35906

Species: Homo sapiens
Genetic Insert: Wnt2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7711; Vector Backbone:pcDNA3.2/V5-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22784633

Proper citation: RRID:Addgene_35906 Copy   


  • RRID:Addgene_35972

    This resource has 1+ mentions.

http://www.addgene.org/35972

Species: Mus musculus
Genetic Insert: zfp423 shRNA
Vector Backbone Description: Backbone Size:6700; Vector Backbone:pMKO.1; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20200519
Comments: Forward Oligo 5' CCGGCCCTGAATGTAACGTGAAGTTCTCGAGAACTTCACGTTACATTCAGGGTTTTTG 3' Reverse Oligo 5' AATTCAAAAACCCTGAATGTAACGTGAAGTTCTCGAGAACTTCACGTTACATTCAGGG 3'

Proper citation: RRID:Addgene_35972 Copy   


http://www.addgene.org/35977

Species: Human Immunodeficiency Virus
Genetic Insert: transactivating protein
Vector Backbone Description: Backbone Marker:Addgene Plasmid Repository; Backbone Size:6963; Vector Backbone:MDH1-PGK-GFP_2.0; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25613133

Proper citation: RRID:Addgene_35977 Copy   


  • RRID:Addgene_35975

http://www.addgene.org/35975

Species: Homo sapiens
Genetic Insert: eukaryotic translation initiation factor 3, subunit F
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5075; Vector Backbone:pcDNA4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19237569
Comments: Please see the following article for additional information on the use of this plasmid: Valente et al., Mol Cell. 2009 Oct 23;36(2):279-89 https://www.ncbi.nlm.nih.gov/pubmed/19854136

Proper citation: RRID:Addgene_35975 Copy   


  • RRID:Addgene_35974

    This resource has 1+ mentions.

http://www.addgene.org/35974

Species: Homo sapiens
Genetic Insert: heterogeneous nuclear ribonucleoprotein U
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25613133

Proper citation: RRID:Addgene_35974 Copy   


http://www.addgene.org/35979

Species: Simian Immunodeficiency Virus
Genetic Insert: transactivating protein
Vector Backbone Description: Backbone Marker:Addgene Plasmid Repository; Backbone Size:6963; Vector Backbone:MDH1-PGK-GFP_2.0; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25613133

Proper citation: RRID:Addgene_35979 Copy   


  • RRID:Addgene_36097

    This resource has 10+ mentions.

http://www.addgene.org/36097

Vector Backbone Description: Backbone Marker:Naldini Lab; Backbone Size:6782; Vector Backbone:pRRLsinPPT-CMV-MCS-WPRE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23792206
Comments: The backbone is described the Naldini group in Dull et al., 1998 (JVI) and was modified by Anthony Oliva and Jia Pingping at the Miami project.

Proper citation: RRID:Addgene_36097 Copy   


  • RRID:Addgene_36096

    This resource has 1+ mentions.

http://www.addgene.org/36096

Species: Homo sapiens
Genetic Insert: FYVE(EEA1) domain
Vector Backbone Description: Vector Backbone:pRS424; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9702203

Proper citation: RRID:Addgene_36096 Copy   


  • RRID:Addgene_36095

    This resource has 1+ mentions.

http://www.addgene.org/36095

Species: Saccharomyces cerevisiae
Genetic Insert: 2xPH(Osh2) fusion
Vector Backbone Description: Vector Backbone:pRS424; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21295699
Comments: Please note that the first Osh2 domain contains aa273-421 and the second Osh2 domains contains aa260-421 when compared to GenBank reference sequence NP_010265.1. According to this reference sequence the PH domain is aa 292–384. The additional residues surrounding the PH domain were intentionally cloned into this construct.

Proper citation: RRID:Addgene_36095 Copy   


  • RRID:Addgene_36099

    This resource has 1+ mentions.

http://www.addgene.org/36099

Vector Backbone Description: Backbone Size:5450; Vector Backbone:pEBB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20671728
Comments: After mammal transfection, supplement fresh media with 4 uM Biotin to "charge" tag by Biotin. Allow cells to grow for about 48 h before the purification steps.

Proper citation: RRID:Addgene_36099 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X