Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Arabidopsis thaliana
Genetic Insert: At2S3 promoter
Vector Backbone Description: Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23669743
Comments: insert can be released with BsaI
Proper citation: RRID:Addgene_68162 Copy
Species: Arabidopsis thaliana
Genetic Insert: AtUbq10 promoter
Vector Backbone Description: Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23669743
Comments: insert can be released with BsaI
Proper citation: RRID:Addgene_68174 Copy
Species: Arabidopsis thaliana
Genetic Insert: AtHsp70B promoter
Vector Backbone Description: Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23669743
Comments: insert can be released with BsaI
Proper citation: RRID:Addgene_68172 Copy
Species: Arabidopsis thaliana
Genetic Insert: AtHsp18.2 promoter
Vector Backbone Description: Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23669743
Comments: insert can be released with BsaI
Proper citation: RRID:Addgene_68171 Copy
Species: Arabidopsis thaliana
Genetic Insert: OPTX promoter with cGMPRE
Vector Backbone Description: Backbone Marker:Calderon-Villalobos et al 2006 Plant Physiol 141:3-14 (GenBank: AY968054.1); Backbone Size:7272; Vector Backbone:pLUC Trap3 (GW); Vector Types:Bacterial Expression, Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24206622
Proper citation: RRID:Addgene_68503 Copy
Species: Arabidopsis thaliana
Genetic Insert: OPTX promoter with GARE
Vector Backbone Description: Backbone Marker:Calderon-Villalobos et al 2006 Plant Physiol 141:3-14 (GenBank: AY968054.1); Backbone Size:7272; Vector Backbone:pLUC Trap3 (GW); Vector Types:Bacterial Expression, Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24206622
Comments: linker sequence between inserted GARE is 5' gagagcc 3'
Proper citation: RRID:Addgene_68542 Copy
Species: Arabidopsis thaliana
Genetic Insert: PhyB
Vector Backbone Description: Backbone Size:7236; Vector Backbone:pRS305; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23761071
Comments: There is a 15-aa linker (EFDSAGSAGSAGGSS) between the PhyB and mCherry and a 10-aa linker (SAGSAGKASG) between mCherry and anchor gene.
Proper citation: RRID:Addgene_51568 Copy
Species: Arabidopsis thaliana
Genetic Insert: PhyB
Vector Backbone Description: Backbone Size:7236; Vector Backbone:pRS305; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23761071
Comments: There is a 15-aa linker (EFDSAGSAGSAGGSS) between the PhyB and mCherry and a 10-aa linker (SAGSAGKASG) between mCherry and anchor gene.
Proper citation: RRID:Addgene_51571 Copy
Species: Arabidopsis thaliana
Genetic Insert: PIF6
Vector Backbone Description: Backbone Size:3657; Vector Backbone:F6A-NAT; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23761071
Comments: the 11-aa linker is AAAGDGAGLIN
Proper citation: RRID:Addgene_51576 Copy
Species: Arabidopsis thaliana
Genetic Insert: PhyB
Vector Backbone Description: Backbone Size:7236; Vector Backbone:pRS305; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23761071
Comments: There is a 15-aa linker (EFDSAGSAGSAGGSS) between the PhyB and mCherry and a 10-aa linker (SAGSAGKASG) between mCherry and anchor gene.
Proper citation: RRID:Addgene_51582 Copy
Species: Arabidopsis thaliana
Genetic Insert: AtMIR390a-B/c
Vector Backbone Description: Backbone Size:2580; Vector Backbone:pENTR; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Kanamycin
Defining Citation: PMID:24647477
Proper citation: RRID:Addgene_51778 Copy
Species: Arabidopsis thaliana
Genetic Insert: AtMIR390a-B/c
Vector Backbone Description: Backbone Size:8754; Vector Backbone:pMDC123; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Kanamycin
Defining Citation: PMID:24647477
Proper citation: RRID:Addgene_51775 Copy
Species: Arabidopsis thaliana
Genetic Insert: AtTAS1c-B/c
Vector Backbone Description: Backbone Size:2580; Vector Backbone:pENTR; Vector Types:GATEWAY-compatible entry clone; Bacterial Resistance:Chloramphenicol and Kanamycin
Defining Citation: PMID:24647477
Proper citation: RRID:Addgene_51774 Copy
Species: Arabidopsis thaliana
Genetic Insert: guide RNA targeting AtPDS3
Vector Backbone Description: Backbone Size:3162; Vector Backbone:pUC119; Vector Types:CRISPR, Plant expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23929339
Comments: gRNA target sequence GGACTTTTGCCAGCCATGGT
This plasmid is used as a PCR template to assemble new desired guide RNA according to the strategy published in Figure S5 of our Nature Biotechnology paper.
Proper citation: RRID:Addgene_52255 Copy
Species: Arabidopsis thaliana
Genetic Insert: 3'UTR, polyadenylation signal/terminator, act2 (A. thaliana)
Vector Backbone Description: Vector Backbone:pICH41276; Vector Types:plant expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:24933124
Comments: insert can be released with BsaI
Proper citation: RRID:Addgene_50340 Copy
Species: Arabidopsis thaliana
Genetic Insert: PhyB 1-908
Vector Backbone Description: Vector Backbone:pHR; Vector Types:Lentiviral, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21909100
Comments: Please note this plasmid is a crucial component of the system described in this additional reference: Toettcher JE, Weiner OD, Lim WA, Cell. 2013 Dec 5;155(6):1422-34. doi: 10.1016/j.cell.2013.11.004. (PMID 24315106)
Proper citation: RRID:Addgene_50839 Copy
Species: Arabidopsis thaliana
Genetic Insert: zep
Vector Backbone Description: Backbone Marker:Francis X. Cunningham, Jr.; Backbone Size:10040; Vector Backbone:pAC-ZEAXipi; Vector Types:low copy number bacterial cloning vector; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:24506237
Comments: For better yield of low copy number pAC-based plasmids, grow liquid cultures on a platform shaker at ca. 30 degrees Celsius. When cultures reach early stationary phase, dilute 2-fold with growth medium, add spectinomycin (150 mg/liter), and "amplify" for several hours before harvest. For plasmid selection and maintenance in E. coli, use chloramphenicol at 30 mg/liter.
Proper citation: RRID:Addgene_53087 Copy
Species: Arabidopsis thaliana
Genetic Insert: lcyE
Vector Backbone Description: Backbone Marker:Francis X. Cunningham, Jr.; Backbone Size:9476; Vector Backbone:pAC-LYC; Vector Types:low copy number bacterial cloning vector; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:8798688
Comments: For better yield of low copy number pAC-based plasmids, grow liquid cultures on a platform shaker at ca. 30 degrees Celsius. When cultures reach early stationary phase, dilute 2-fold with growth medium, add spectinomycin (150 mg/liter), and "amplify" for several hours before harvest. For plasmid selection and maintenance in E. coli, use chloramphenicol at 30 mg/liter.
Proper citation: RRID:Addgene_53273 Copy
Species: Arabidopsis thaliana
Genetic Insert: chyB1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4414; Vector Backbone:pTrcHis A; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15659105
Proper citation: RRID:Addgene_53367 Copy
Species: Arabidopsis thaliana
Genetic Insert: UBQ10 promoter
Vector Backbone Description: Backbone Marker:Mark Curtis at ETH Zurich (Brand et al., Plant Physiology 2006); Vector Backbone:pLB12; Vector Types:Other, plant expression; Bacterial Resistance:Spectinomycin
Comments: The vector pLB12 contains both an activator unit and a b-glucuronidase (GUS) reporter within a responder unit.
Proper citation: RRID:Addgene_53449 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
