Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: PIGA zinc finger R2
Vector Backbone Description: Backbone Marker:Keith Joung lab @ MGH/HMS; Backbone Size:5709; Vector Backbone:pST1374; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19540188
Comments: Please also cite the original article from Joung lab describing the construction of zinc finger nuclease:
Maeder ML, Thibodeau-Beganny S, Osiak A, Wright DA, Anthony RM, et al. Rapid “open-source” engineering of customized zinc-finger nucleases for highly efficient gene modification. Mol Cell. 2008;31:294–301.
Proper citation: RRID:Addgene_37800 Copy
Species: Synthetic
Genetic Insert: MBP (Maltose binding protein)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5200; Vector Backbone:FastBac-Dual; Vector Types:Insect Expression, Baculovirus expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_38008 Copy
Species: Synthetic
Genetic Insert: Avian sarcoma and leukemia virus receptor 950
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:5604; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22681690
Proper citation: RRID:Addgene_38044 Copy
Species: Synthetic
Genetic Insert: GoldyTALEN
Vector Backbone Description: Backbone Size:2900; Vector Backbone:pBSK; Vector Types:mRNA transcription vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23027955
Comments: Please note that this plasmid can be prone to recombination in bacteria. We recommend storing and propagating the construct in Stbl3 cells and screen 4-6 colonies by sequencing with TAL_F1 (ttggcgtcggcaaacagtgg) primer.
The F1 origin feature in the full plasmid sequence is in reverse compliment orientation. Please view Addgene's quality control sequence for the most accurate information. The flipped orientation does not affect the SacI site necessary to linearize the plasmid.
For further reference, this plasmid was also used in the Bedell et al Nature 2012 publication (PMID 23000899).
For more information on Carlson TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#carlson
Proper citation: RRID:Addgene_38142 Copy
Species: Synthetic
Genetic Insert: GoldyTALEN
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pBSK; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23027955
Comments: For further reference, this plasmid was also used in the Bedell et al Nature 2012 publication (PMID 23000899).
For more information on Carlson TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#carlson
Proper citation: RRID:Addgene_38143 Copy
Species: Synthetic
Genetic Insert: mKate2
Vector Backbone Description: Vector Backbone:Phi80; Vector Types:Synthetic Biology, Integration vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22615351
Comments: This strain contains Addgene plasmid 38200 chromosomally integrated at the Phi80 (Haldimann et al., J of Bacteriology 2001) site of DH5alphaZ1 strain.
Proper citation: RRID:Addgene_38203 Copy
Species: Synthetic
Genetic Insert: mKate2
Vector Backbone Description: Vector Backbone:Phi80; Vector Types:Synthetic Biology, Integration vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22615351
Comments: This construct has attL and attR sites (LR).
To integrate on your favorite E.coli strain, transform in strain containing the pAH123 plasmid (Haldimann et al., J of Bacteriology 2001). Contains a R6K origin of replication, will only replicate in pir2+ strains.
Proper citation: RRID:Addgene_38200 Copy
Species: Synthetic
Genetic Insert: mKate2
Vector Backbone Description: Vector Backbone:Phi80; Vector Types:Synthetic Biology, Integration vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22615351
Comments: This strain contains Addgene plasmid 38170 chromosomally integrated at the Phi80 (Haldimann et al., J of Bacteriology 2001) site of DH5alphaZ1 strain.
Proper citation: RRID:Addgene_38202 Copy
Species: Synthetic
Genetic Insert: E2-Crimson
Vector Backbone Description: Backbone Marker:Glick Lab; Backbone Size:4313; Vector Backbone:YIPlac204TKC-DsRed-HDEL (Addgene Plasmid #21770); Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19658435
Comments: Vector for targeting E2-Crimson to the ER in yeast cells.
Linearize with EcoRV to integrate at TRP
Substitutions in E2-Crimson relative to DsRed-Express2 are: E32V, Q66F, V71A, V73I, K83L, L85Q, F118L, L150N, I161N, K163M, V175C, Y193H, S197Y
Proper citation: RRID:Addgene_38771 Copy
Species: Synthetic
Genetic Insert: E2-Crimson
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5603; Vector Backbone:pEF/myc/ER; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19658435
Comments: Vector for targeting E2-Crimson to the ER in mammalian cells.
Substitutions in E2-Crimson relative to DsRed-Express2 are: E32V, Q66F, V71A, V73I, K83L, L85Q, F118L, L150N, I161N, K163M, V175C, Y193H, S197Y
IMPORTANT NOTE: There is an 82-bp intron after the ER signal sequence. The signal sequence will be in frame with the final product.
Proper citation: RRID:Addgene_38770 Copy
Species: Synthetic
Genetic Insert: gRNA core
Vector Backbone Description: Backbone Size:2400; Vector Backbone:pUC19; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23918387
Comments: For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/
Proper citation: RRID:Addgene_46759 Copy
Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Size:2800; Vector Backbone:pT3T7; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23918387
Comments: For more information on Chen and Wente Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Chen/
Proper citation: RRID:Addgene_46757 Copy
Species: Synthetic
Genetic Insert: AtU6p::sgRNA_PDS
Vector Backbone Description: Backbone Size:6340; Vector Backbone:pICH86966; Vector Types:CRISPR, Plant expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23929340
Comments: gRNA target sequence GCCGTTAATTTGAGAGTCCA
Proper citation: RRID:Addgene_46966 Copy
Species: Synthetic
Genetic Insert: FLAG tag
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23897892
Proper citation: RRID:Addgene_46956 Copy
Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Size:2300; Vector Backbone:pCFJ601; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23995389
Comments: For more information on Goldstein Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Goldstein/
Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3
Proper citation: RRID:Addgene_47549 Copy
Species: Synthetic
Genetic Insert: SOX2 shRNA
Vector Backbone Description: Backbone Size:10633; Vector Backbone:Tet-pLKO-puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22941189
Proper citation: RRID:Addgene_47540 Copy
Species: Synthetic
Genetic Insert: gRNA-EGFP site 2
Vector Backbone Description: Backbone Marker:Joung lab (Addgene plasmid #43860); Backbone Size:2278; Vector Backbone:MLM3636; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23792628
Comments: Target site: GATGCCGTTCTTCTGCTTGT
gRNA expression vector targeting EGFP for use with JDS246 (Addgene plasmid# 43861--mammalian codon-optimized streptococcus pyogenes Cas9)
Proper citation: RRID:Addgene_47512 Copy
Species: Synthetic
Genetic Insert: TALE(Grm2)-GS-CIB1(NLS*,∆318-334)
Vector Backbone Description: Backbone Marker:Zhang Lab; Backbone Size:4280; Vector Backbone:pAAV_hSyn_WPRE_bGHpA; Vector Types:Mammalian Expression, AAV, TALE; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23877069
Proper citation: RRID:Addgene_47456 Copy
Species: Synthetic
Genetic Insert: NLS(alpha-imp)-CRY2PHR-NLS-VP64
Vector Backbone Description: Backbone Marker:Zhang Lab; Backbone Size:4280; Vector Backbone:pAAV_hSyn_WPRE_bGHpA; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23877069
Proper citation: RRID:Addgene_47455 Copy
Species: Synthetic
Genetic Insert: TALE BB(N136_0.5HD_C63)-VP64
Vector Backbone Description: Backbone Marker:Zhang Lab; Backbone Size:4281; Vector Backbone:pAAV_hSyn_WPRE_bGHpA; Vector Types:Mammalian Expression, AAV, TALE; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23877069
Proper citation: RRID:Addgene_47446 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
