Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pKD4 Resource Report Resource Website 10+ mentions |
RRID:Addgene_45605 | FRT-kan-FRT | Ampicillin and Kanamycin | PMID:10829079 | This is a template plasmids for frt-flanked kan cassette. The kan cassette originally came from pCP15. pKD3 and pKD4 are identical except for the region between the FRT sites, so they create an identical scar that has stop codons in all six reading frames. As drawn in the map, this scar has an idealized ribosome binding site and start codon for downstream (rightward) gene expression. | Backbone Marker:M. Koob (University of Wisconsin, Madison); Vector Backbone:pANTSγ; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:15:25 | 28 | ||
|
pBlueKan+cysMPro Resource Report Resource Website |
RRID:Addgene_187879 | Ampicillin and Kanamycin | PMID:35416085 | Backbone Marker:Stratagene (Agilent Tech); Backbone Size:2864; Vector Backbone:pBluescript KS(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:23:34 | 0 | ||||
|
AAV_Actb HR donor Resource Report Resource Website 1+ mentions |
RRID:Addgene_97317 | Actb HR donor | Synthetic | Ampicillin and Kanamycin | PMID:28524166 | Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:34 | 2 | ||
|
AAV_Actb HMEJ donor Resource Report Resource Website |
RRID:Addgene_97318 | Actb HMEJ donor | Synthetic | Ampicillin and Kanamycin | PMID:28524166 | gRNA sequence: agtccgcctagaagcacttg | Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:34 | 0 | |
|
AAV_Dbh HMEJ donor Resource Report Resource Website |
RRID:Addgene_97320 | Dbh HMEJ donor | Synthetic | Ampicillin and Kanamycin | PMID:28524166 | gRNA sequence: agaatagcttctcacaaggt | Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:34 | 0 | |
|
pRRG763-CRELD Resource Report Resource Website |
RRID:Addgene_99092 | CRELD in situ probe | Schmidtea mediterranea | Ampicillin and Kanamycin | PMID:27612384 | Cloning primers: F-AAAAATTGTGCCCATCTTCG, R-TGATTCCATCCTTCAGCACA | Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:44 | 0 | |
|
pRRG43-sFRP1 Resource Report Resource Website |
RRID:Addgene_99071 | sFRP1 (secreted frizzled related protein 1) in situ probe | Schmidtea mediterranea | Ampicillin and Kanamycin | PMID:23297191 | Cloning primers: F-AAACACTCAATGCCATGTCG, R-GTTGTCGCTGTCGATTTGTG | Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:44 | 0 | |
|
pRRG757-smedwi-1 Resource Report Resource Website |
RRID:Addgene_99074 | Smedwi-1 in situ probe | Schmidtea mediterranea | Ampicillin and Kanamycin | PMID:23297191 | Cloning primers: F-CGTTCCTAAAGGCACAGCTC, R-TTGGATTAGCCCCATCTTTG | Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:44 | 0 | |
|
pRRG227-Wnt1 Resource Report Resource Website |
RRID:Addgene_99073 | Wnt1 (also known as WntP-1) in situ probe | Schmidtea mediterranea | Ampicillin and Kanamycin | PMID:23297191 | Cloning primers: F-AATCATCGCTGGAACTGTCC, R-TGTGGCAAATTTTGGTCGTA | Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:42 | 0 | |
|
pRRG128-activin Resource Report Resource Website |
RRID:Addgene_99075 | Activin (also known as activin 2) in situ probe | Schmidtea mediterranea | Ampicillin and Kanamycin | PMID:23297191 | Cloning primers: F-GGCCTTTGAAAGAACAGTGG, R-CTTCCTCGAGCGAAATTCAG | Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:42 | 0 | |
|
pRRG223-smad2/3 Resource Report Resource Website |
RRID:Addgene_99078 | Smad2/3 in situ probe | Schmidtea mediterranea | Ampicillin and Kanamycin | PMID:23297191 | Cloning primers: F-CATGGAAACAAGCATTGTGG, R-GGTGGGATCTTGCAAACTGT | Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:42 | 0 | |
|
pRRG245-Ras-related Resource Report Resource Website |
RRID:Addgene_99079 | Ras-related (also known as h.18.4a) in situ probe | Schmidtea mediterranea | Ampicillin and Kanamycin | PMID:23297191 | Cloning primers: F-TGTGCGCTATCGTCAAAAAG, R-TTGAGATTACGAAGTCGACGAA | Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:42 | 0 | |
|
pRRG260-Cyp1A1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_99081 | Cyp1A1 (also known as h.49.4f) in situ probe | Schmidtea mediterranea | Ampicillin and Kanamycin | PMID:23297191 | Cloning primers: F-TTGAAATTGGAGCGAAAATTAAA, R-GGGGAAATTCTTGAACCCTTC Note: The Cyp1A1 insert contains several mismatches compared to AY067980.1. The depositor has confirmed this does not impact plasmid function. | Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:42 | 1 | |
|
pRRG272-eya Resource Report Resource Website |
RRID:Addgene_99085 | eyes absent (eya) | Other | Ampicillin and Kanamycin | PMID:23297191 | Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:42 | 0 | ||
|
pRRG389-PC2 Resource Report Resource Website |
RRID:Addgene_99087 | prohormone convertase 2 (PC2) | Other | Ampicillin and Kanamycin | PMID:23297191 | Cloning primers: F-TCGTTGCACACCTGTACCAT, R-CACTCCAACACCACAAATGC | Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:42 | 0 | |
|
pRRG217-soxB Resource Report Resource Website |
RRID:Addgene_99086 | soxB (also known as soxB1-1) in situ probe | Schmidtea mediterranea | Ampicillin and Kanamycin | PMID:23297191 | Cloning primers: F-TACTCATCCGCCCTTTCATC, R-CCGATCAATGTCTTCGGACT | Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:44 | 0 | |
|
pRRG764-SoxB2-2 Resource Report Resource Website |
RRID:Addgene_99088 | SoxB2-2 in situ probe | Schmidtea mediterranea | Ampicillin and Kanamycin | PMID:27612384 | Cloning primers: F-CGGTTACAGCGATGAAGACA, R-GAGAGTGACGGCAGAGTTCC | Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:42 | 0 | |
|
pRRG867-hesl-3 Resource Report Resource Website |
RRID:Addgene_99090 | Hesl-3 (hes-like) in situ probe | Schmidtea mediterranea | Ampicillin and Kanamycin | PMID:27612384 | Cloning primers: F-GGCAGAGCTCAAAGAATTGG, R-AACGGCCAGCTTTAGGATTT | Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:42 | 0 | |
|
pRRG88-follistatin Resource Report Resource Website |
RRID:Addgene_99066 | follistatin in situ probe | Schmidtea mediterranea | Ampicillin and Kanamycin | PMID:23297191 | Cloning primers: F-TATGTCCGGTCGGAGAGTTT, R-GAGGTGGGGCATTTGATACA | Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:42 | 0 | |
|
pRRG170-LDLRR-2 Resource Report Resource Website |
RRID:Addgene_99094 | LDLRR-2 in situ probe | Schmidtea mediterranea | Ampicillin and Kanamycin | PMID:27612384 | Cloning primers: F-GCCCAGACAAAGAAGATGGA, R-TGTTGCACAGCATTCGTTTT Note: the LDLRR-2 insert has a 15 base pair deletion compared to JX010572.1. The depositor has confirmed this does not affect plasmid function. | Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:43 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
