Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pPAt2S3 (GB0029) Resource Report Resource Website |
RRID:Addgene_68162 | At2S3 promoter | Arabidopsis thaliana | Ampicillin | PMID:23669743 | insert can be released with BsaI | Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin | BsaI and BsmBI sites removed | 2026-08-15 01:18:41 | 0 |
|
pPAtUbq10 (GB0223) Resource Report Resource Website 1+ mentions |
RRID:Addgene_68174 | AtUbq10 promoter | Arabidopsis thaliana | Ampicillin | PMID:23669743 | insert can be released with BsaI | Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin | BsaI and BsmBI sites removed | 2026-08-15 01:18:41 | 1 |
|
pHsp70B (GB0155) Resource Report Resource Website |
RRID:Addgene_68172 | AtHsp70B promoter | Arabidopsis thaliana | Ampicillin | PMID:23669743 | insert can be released with BsaI | Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin | BsaI and BsmBI sites removed | 2026-08-15 01:18:45 | 0 |
|
pHsp18.2 (GB0153) Resource Report Resource Website |
RRID:Addgene_68171 | AtHsp18.2 promoter | Arabidopsis thaliana | Ampicillin | PMID:23669743 | insert can be released with BsaI | Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin | BsaI and BsmBI sites removed | 2026-08-15 01:18:41 | 0 |
|
pOPTXcGMPRELUC Resource Report Resource Website 1+ mentions |
RRID:Addgene_68503 | OPTX promoter with cGMPRE | Arabidopsis thaliana | Kanamycin | PMID:24206622 | Backbone Marker:Calderon-Villalobos et al 2006 Plant Physiol 141:3-14 (GenBank: AY968054.1); Backbone Size:7272; Vector Backbone:pLUC Trap3 (GW); Vector Types:Bacterial Expression, Plant Expression; Bacterial Resistance:Kanamycin | 3x cGMPRE inserted 190bp 5' of ATG (cGMPRE = aaatagatttcaacagtt) | 2026-08-15 01:18:44 | 1 | |
|
pOPTXGARE Resource Report Resource Website |
RRID:Addgene_68542 | OPTX promoter with GARE | Arabidopsis thaliana | Kanamycin | PMID:24206622 | linker sequence between inserted GARE is 5' gagagcc 3' | Backbone Marker:Calderon-Villalobos et al 2006 Plant Physiol 141:3-14 (GenBank: AY968054.1); Backbone Size:7272; Vector Backbone:pLUC Trap3 (GW); Vector Types:Bacterial Expression, Plant Expression; Bacterial Resistance:Kanamycin | 5x GARE inserted 190 bp 5' pf ATG (GARE = taacaaa) | 2026-08-15 01:18:44 | 0 |
|
PhyB-mCherry-CDC10 Resource Report Resource Website |
RRID:Addgene_51568 | PhyB | Arabidopsis thaliana | Ampicillin | PMID:23761071 | There is a 15-aa linker (EFDSAGSAGSAGGSS) between the PhyB and mCherry and a 10-aa linker (SAGSAGKASG) between mCherry and anchor gene. | Backbone Size:7236; Vector Backbone:pRS305; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 1-908aa only | 2026-08-15 01:16:15 | 0 |
|
PhyB-mCherry-NLS Resource Report Resource Website 1+ mentions |
RRID:Addgene_51571 | PhyB | Arabidopsis thaliana | Ampicillin | PMID:23761071 | There is a 15-aa linker (EFDSAGSAGSAGGSS) between the PhyB and mCherry and a 10-aa linker (SAGSAGKASG) between mCherry and anchor gene. | Backbone Size:7236; Vector Backbone:pRS305; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 1-908aa only | 2026-08-15 01:16:15 | 1 |
|
linker-mCitrine-PIF6-NAT Resource Report Resource Website |
RRID:Addgene_51576 | PIF6 | Arabidopsis thaliana | Ampicillin | PMID:23761071 | the 11-aa linker is AAAGDGAGLIN | Backbone Size:3657; Vector Backbone:F6A-NAT; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 1-100aa of PIF6 | 2026-08-15 01:16:15 | 0 |
|
PhyB-mCherry-Spc72 Resource Report Resource Website |
RRID:Addgene_51582 | PhyB | Arabidopsis thaliana | Ampicillin | PMID:23761071 | There is a 15-aa linker (EFDSAGSAGSAGGSS) between the PhyB and mCherry and a 10-aa linker (SAGSAGKASG) between mCherry and anchor gene. | Backbone Size:7236; Vector Backbone:pRS305; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 1-908aa only | 2026-08-15 01:16:19 | 0 |
|
pENTR-AtMIR390a-B/c Resource Report Resource Website 1+ mentions |
RRID:Addgene_51778 | AtMIR390a-B/c | Arabidopsis thaliana | Chloramphenicol and Kanamycin | PMID:24647477 | Backbone Size:2580; Vector Backbone:pENTR; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Kanamycin | A. thaliana MIR390a precursor sequence including a chloramphenicol-ccdB cassette flanked by two inverted BsaI sites. The BsaI site in the ccdB gene was mutated to block the site. | 2026-08-15 01:16:21 | 4 | |
|
pMDC123SB-AtMIR390a-B/c Resource Report Resource Website 1+ mentions |
RRID:Addgene_51775 | AtMIR390a-B/c | Arabidopsis thaliana | Chloramphenicol and Kanamycin | PMID:24647477 | Backbone Size:8754; Vector Backbone:pMDC123; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Kanamycin | A. thaliana MIR390a precursor sequence including a chloramphenicol-ccdB cassette flanked by two inverted BsaI sites. The BsaI site in the ccdB gene was mutated to block the site. | 2026-08-15 01:16:21 | 1 | |
|
pENTR-AtTAS1c-B/c Resource Report Resource Website 1+ mentions |
RRID:Addgene_51774 | AtTAS1c-B/c | Arabidopsis thaliana | Chloramphenicol and Kanamycin | PMID:24647477 | Backbone Size:2580; Vector Backbone:pENTR; Vector Types:GATEWAY-compatible entry clone; Bacterial Resistance:Chloramphenicol and Kanamycin | A. thaliana TAS1c precursor sequence including a chloramphenicol-ccdB cassette flanked by two inverted BsaI sites. The BsaI site in the ccdB gene was mutated to block the site. | 2026-08-15 01:16:17 | 1 | |
|
pUC119-gRNA Resource Report Resource Website 1+ mentions |
RRID:Addgene_52255 | guide RNA targeting AtPDS3 | Arabidopsis thaliana | Ampicillin | PMID:23929339 | gRNA target sequence GGACTTTTGCCAGCCATGGT This plasmid is used as a PCR template to assemble new desired guide RNA according to the strategy published in Figure S5 of our Nature Biotechnology paper. | Backbone Size:3162; Vector Backbone:pUC119; Vector Types:CRISPR, Plant expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:26 | 6 | |
|
pICH44300 Resource Report Resource Website 1+ mentions |
RRID:Addgene_50340 | 3'UTR, polyadenylation signal/terminator, act2 (A. thaliana) | Arabidopsis thaliana | Spectinomycin | PMID:24933124 | insert can be released with BsaI | Vector Backbone:pICH41276; Vector Types:plant expression; Bacterial Resistance:Spectinomycin | BsaI/BbsI sites removed by point-mutation | 2026-08-15 01:16:05 | 1 |
|
pHR SFFVp Phy-mCherry-CAAX Resource Report Resource Website 1+ mentions |
RRID:Addgene_50839 | PhyB 1-908 | Arabidopsis thaliana | Ampicillin | PMID:21909100 | Please note this plasmid is a crucial component of the system described in this additional reference: Toettcher JE, Weiner OD, Lim WA, Cell. 2013 Dec 5;155(6):1422-34. doi: 10.1016/j.cell.2013.11.004. (PMID 24315106) | Vector Backbone:pHR; Vector Types:Lentiviral, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:09 | 4 | |
|
pAC-VIOL Resource Report Resource Website |
RRID:Addgene_53087 | zep | Arabidopsis thaliana | Chloramphenicol | PMID:24506237 | For better yield of low copy number pAC-based plasmids, grow liquid cultures on a platform shaker at ca. 30 degrees Celsius. When cultures reach early stationary phase, dilute 2-fold with growth medium, add spectinomycin (150 mg/liter), and "amplify" for several hours before harvest. For plasmid selection and maintenance in E. coli, use chloramphenicol at 30 mg/liter. | Backbone Marker:Francis X. Cunningham, Jr.; Backbone Size:10040; Vector Backbone:pAC-ZEAXipi; Vector Types:low copy number bacterial cloning vector; Bacterial Resistance:Chloramphenicol | Lacks codons for the first 60 N-terminal amino acids that are thought to comprise the chloroplast transit sequence | 2026-08-15 01:16:32 | 0 |
|
pAC-DELTA Resource Report Resource Website 1+ mentions |
RRID:Addgene_53273 | lcyE | Arabidopsis thaliana | Chloramphenicol | PMID:8798688 | For better yield of low copy number pAC-based plasmids, grow liquid cultures on a platform shaker at ca. 30 degrees Celsius. When cultures reach early stationary phase, dilute 2-fold with growth medium, add spectinomycin (150 mg/liter), and "amplify" for several hours before harvest. For plasmid selection and maintenance in E. coli, use chloramphenicol at 30 mg/liter. | Backbone Marker:Francis X. Cunningham, Jr.; Backbone Size:9476; Vector Backbone:pAC-LYC; Vector Types:low copy number bacterial cloning vector; Bacterial Resistance:Chloramphenicol | 2026-08-15 01:16:32 | 1 | |
|
pAtCHYb1Δ129N Resource Report Resource Website |
RRID:Addgene_53367 | chyB1 | Arabidopsis thaliana | Ampicillin | PMID:15659105 | Backbone Marker:Invitrogen; Backbone Size:4414; Vector Backbone:pTrcHis A; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Deleted codons for the first 129 amino acids | 2026-08-15 01:16:33 | 0 | |
|
AtUBQ10+pLB12 Resource Report Resource Website |
RRID:Addgene_53449 | UBQ10 promoter | Arabidopsis thaliana | Spectinomycin | The vector pLB12 contains both an activator unit and a b-glucuronidase (GUS) reporter within a responder unit. | Backbone Marker:Mark Curtis at ETH Zurich (Brand et al., Plant Physiology 2006); Vector Backbone:pLB12; Vector Types:Other, plant expression; Bacterial Resistance:Spectinomycin | 2026-08-15 01:16:30 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
