Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: HOXB5
Vector Backbone Description: Vector Backbone:pPB-cT3G-cERH; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: There is an amino acid substitution in the P2A linker. Depositor confirms this does not affect HOXB5 expression and hygromycin resistance, but notes that the cleavage efficiency may be reduced.
Please visit https://doi.org/10.1101/2024.05.31.596483 for bioRxiv preprint.
Proper citation: RRID:Addgene_222584 Copy
Species: Homo sapiens
Genetic Insert: Polyribonucleotide Nucleotidyltransferase 1
Vector Backbone Description: Vector Backbone:pLenti-CMV-Puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37924812
Proper citation: RRID:Addgene_223315 Copy
Species: Homo sapiens
Genetic Insert: Htt103QdeltaP141-160
Vector Backbone Description: Backbone Size:6070; Vector Backbone:pRS416; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_224886 Copy
Species: Homo sapiens
Genetic Insert: Htt103QdeltaP135-170
Vector Backbone Description: Backbone Size:6069; Vector Backbone:pRS416; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_224878 Copy
Species: Homo sapiens
Genetic Insert: GAPDH fused with RGG domain of TOP3B
Vector Backbone Description: Backbone Marker:Mayr Lab; Vector Backbone:pcDNA3-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37961296
Comments: Please visit https://doi.org/10.1101/2023.11.05.565677 for bioRxiv preprint.
Proper citation: RRID:Addgene_225477 Copy
Species: Homo sapiens
Genetic Insert: GNB1L
Vector Backbone Description: Vector Backbone:pLenti-CMV-Puro; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37541219
Proper citation: RRID:Addgene_224387 Copy
Species: Homo sapiens
Genetic Insert: GNB1L
Vector Backbone Description: Vector Backbone:pLenti-CMV-Puro; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37541219
Proper citation: RRID:Addgene_224388 Copy
Species: Homo sapiens
Genetic Insert: ROCK2
Vector Backbone Description: Backbone Marker:Mayr Lab; Vector Backbone:pcDNA3-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37961296
Comments: Please visit https://doi.org/10.1101/2023.11.05.565677 for bioRxiv preprint.
Proper citation: RRID:Addgene_225472 Copy
Species: Homo sapiens
Genetic Insert: FXR1 isoform a
Vector Backbone Description: Backbone Marker:Mayr Lab; Vector Backbone:pcDNA3-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37961296
Comments: Resistant to shRNA TRCN0000164818 (target sequence CCAGCGAATCTCATCACAGTA). Please visit https://doi.org/10.1101/2023.11.05.565677 for bioRxiv preprint.
Proper citation: RRID:Addgene_225467 Copy
Species: Homo sapiens
Genetic Insert: COX8A
Vector Backbone Description: Vector Backbone:pcs2-GFP-IRES-mCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38297121
Comments: Cloned into BsmBI digested pcs2-GFP-IRES-mCherry.
Proper citation: RRID:Addgene_226104 Copy
Species: Homo sapiens
Genetic Insert: COX8A
Vector Backbone Description: Vector Backbone:pcs2-GFP-IRES-mCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38297121
Comments: Cloned into BsmBI digested pcs2-GFP-IRES-mCherry.
Proper citation: RRID:Addgene_226103 Copy
Species: Homo sapiens
Genetic Insert: DELE1
Vector Backbone Description: Vector Backbone:pcs2-GFP-IRES-mCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38297121
Comments: Cloned into BsmBI digested pcs2-GFP-IRES-mCherry.
Proper citation: RRID:Addgene_226102 Copy
Species: Homo sapiens
Genetic Insert: DMC1
Vector Backbone Description: Vector Backbone:pPB-cT3G-cERP2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/2024.05.31.596483 for bioRxiv preprint.
Proper citation: RRID:Addgene_222541 Copy
Species: Homo sapiens
Genetic Insert: gRNA for editing FXR1-KH1
Vector Backbone Description: Backbone Marker:Charles Gersbach (Addgene # 47108); Vector Backbone:SpCas9 gRNA backbone; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37961296
Comments: Please visit https://doi.org/10.1101/2023.11.05.565677 for bioRxiv preprint.
Proper citation: RRID:Addgene_225483 Copy
Species: Homo sapiens
Genetic Insert: gRNA for editing FXR1-N202S
Vector Backbone Description: Backbone Marker:Keith Joung (Addgene # 65777); Vector Backbone:SpCas9 gRNA backbone; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37961296
Comments: Please visit https://doi.org/10.1101/2023.11.05.565677 for bioRxiv preprint.
Proper citation: RRID:Addgene_225481 Copy
Species: Homo sapiens
Genetic Insert: IFNA
Vector Backbone Description: Backbone Size:7561; Vector Backbone:pCDH; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39349746
Comments: Please visit https://www.doi.org/10.17632/g75gzdwbks.1 for preprint.
Proper citation: RRID:Addgene_225710 Copy
Species: Homo sapiens
Genetic Insert: BATF
Vector Backbone Description: Backbone Size:6638; Vector Backbone:SFFV-MCS; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41539305
Comments: Barcode sequence cloned into XbaI restriction site. Design of plasmid is as follows: SFFV-[TF sequence]-WPRE-[Barcode sequence].
Proper citation: RRID:Addgene_219026 Copy
Species: Homo sapiens
Genetic Insert: NFE2
Vector Backbone Description: Backbone Size:6638; Vector Backbone:SFFV-MCS; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41539305
Comments: Barcode sequence cloned into XbaI restriction site. Design of plasmid is as follows: SFFV-[TF sequence]-WPRE-[Barcode sequence].
Proper citation: RRID:Addgene_219024 Copy
Species: Homo sapiens
Genetic Insert: IRF2
Vector Backbone Description: Backbone Size:6638; Vector Backbone:SFFV-MCS; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41539305
Comments: Barcode sequence cloned into XbaI restriction site. Design of plasmid is as follows: SFFV-[TF sequence]-WPRE-[Barcode sequence].
Proper citation: RRID:Addgene_218989 Copy
Species: Homo sapiens
Genetic Insert: BCL11B
Vector Backbone Description: Backbone Size:6638; Vector Backbone:SFFV-MCS; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41539305
Comments: Barcode sequence cloned into XbaI restriction site. Design of plasmid is as follows: SFFV-[TF sequence]-WPRE-[Barcode sequence].
Proper citation: RRID:Addgene_219038 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
