Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: BATF3
Vector Backbone Description: Backbone Size:6638; Vector Backbone:SFFV-MCS; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41539305
Comments: Barcode sequence cloned into XbaI restriction site. Design of plasmid is as follows: SFFV-[TF sequence]-WPRE-[Barcode sequence].
Proper citation: RRID:Addgene_218987 Copy
Species: Homo sapiens
Genetic Insert: FXR1 isoform a
Vector Backbone Description: Backbone Marker:Mayr Lab; Vector Backbone:pcDNA3-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37961296
Comments: Resistant to shRNA TRCN0000164818 (target sequence CCAGCGAATCTCATCACAGTA). Please visit https://doi.org/10.1101/2023.11.05.565677 for bioRxiv preprint.
Proper citation: RRID:Addgene_225454 Copy
Species: Homo sapiens
Genetic Insert: FXR1 isoform a
Vector Backbone Description: Backbone Marker:Mayr Lab; Vector Backbone:pcDNA3-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37961296
Comments: Resistant to shRNA TRCN0000164818 (target sequence CCAGCGAATCTCATCACAGTA). Please visit https://doi.org/10.1101/2023.11.05.565677 for bioRxiv preprint.
Proper citation: RRID:Addgene_225459 Copy
Species: Homo sapiens
Genetic Insert: FXR1 isoform a
Vector Backbone Description: Backbone Marker:Mayr Lab; Vector Backbone:pcDNA3-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37961296
Comments: Resistant to shRNA TRCN0000164818 (target sequence CCAGCGAATCTCATCACAGTA). Please visit https://doi.org/10.1101/2023.11.05.565677 for bioRxiv preprint.
Proper citation: RRID:Addgene_225458 Copy
Species: Homo sapiens
Genetic Insert: FXR1 isoform a
Vector Backbone Description: Backbone Marker:Mayr Lab; Vector Backbone:pcDNA3-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37961296
Comments: Resistant to shRNA TRCN0000164818 (target sequence CCAGCGAATCTCATCACAGTA). Please visit https://doi.org/10.1101/2023.11.05.565677 for bioRxiv preprint.
Proper citation: RRID:Addgene_225457 Copy
Species: Homo sapiens
Genetic Insert: FXR1 isoform a
Vector Backbone Description: Backbone Marker:Mayr Lab; Vector Backbone:pcDNA3-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37961296
Comments: Resistant to shRNA TRCN0000164818 (target sequence CCAGCGAATCTCATCACAGTA). Please visit https://doi.org/10.1101/2023.11.05.565677 for bioRxiv preprint.
Proper citation: RRID:Addgene_225456 Copy
Species: Homo sapiens
Genetic Insert: CIRTS-YTHDF2-Calm3-U6-control gRNA
Vector Backbone Description: Backbone Marker:Addgene; Backbone Size:9801; Vector Backbone:pFsy(1.1)GW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37669863
Proper citation: RRID:Addgene_216857 Copy
Species: Homo sapiens
Genetic Insert: MXD1
Vector Backbone Description: Backbone Size:6638; Vector Backbone:SFFV-MCS; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41539305
Comments: Barcode sequence cloned into XbaI restriction site. Design of plasmid is as follows: SFFV-[TF sequence]-WPRE-[Barcode sequence].
Proper citation: RRID:Addgene_218999 Copy
Species: Homo sapiens
Genetic Insert: ETS1
Vector Backbone Description: Backbone Size:6638; Vector Backbone:SFFV-MCS; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41539305
Comments: Barcode sequence cloned into XbaI restriction site. Design of plasmid is as follows: SFFV-[TF sequence]-WPRE-[Barcode sequence].
Proper citation: RRID:Addgene_218998 Copy
Species: Homo sapiens
Genetic Insert: NFATC3
Vector Backbone Description: Backbone Size:6638; Vector Backbone:SFFV-MCS; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41539305
Comments: Barcode sequence cloned into XbaI restriction site. Design of plasmid is as follows: SFFV-[TF sequence]-WPRE-[Barcode sequence].
Proper citation: RRID:Addgene_218995 Copy
Species: Homo sapiens
Genetic Insert: TBX21
Vector Backbone Description: Backbone Size:6638; Vector Backbone:SFFV-MCS; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41539305
Comments: Barcode sequence cloned into XbaI restriction site. Design of plasmid is as follows: SFFV-[TF sequence]-WPRE-[Barcode sequence].
Proper citation: RRID:Addgene_218996 Copy
Species: Homo sapiens
Genetic Insert: TOP3B
Vector Backbone Description: Backbone Marker:Mayr Lab; Vector Backbone:pcDNA3-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37961296
Comments: Please visit https://doi.org/10.1101/2023.11.05.565677 for bioRxiv preprint.
Proper citation: RRID:Addgene_225470 Copy
Species: Homo sapiens
Genetic Insert: eIF3D
Vector Backbone Description: Backbone Marker:Jonathan Weissman, Addgene plasmid #85996; Vector Backbone:pMJ179; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37144468
Proper citation: RRID:Addgene_222125 Copy
Species: Homo sapiens
Genetic Insert: GAPDH fused with R-rich region of TDRD3
Vector Backbone Description: Backbone Marker:Mayr Lab; Vector Backbone:pcDNA3-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37961296
Comments: Please visit https://doi.org/10.1101/2023.11.05.565677 for bioRxiv preprint.
Proper citation: RRID:Addgene_225480 Copy
Species: Homo sapiens
Genetic Insert: FMR1 isoform 1
Vector Backbone Description: Backbone Marker:Mayr Lab; Vector Backbone:pcDNA3-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37961296
Comments: Resistant to shRNA TRCN0000059759 (target sequence GCGTTTGGAGAGATTACAAAT). Please visit https://doi.org/10.1101/2023.11.05.565677 for bioRxiv preprint.
Proper citation: RRID:Addgene_225462 Copy
Species: Homo sapiens
Genetic Insert: FXR1 isoform a
Vector Backbone Description: Backbone Marker:Mayr Lab; Vector Backbone:pcDNA3-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37961296
Comments: Resistant to shRNA TRCN0000164818 (target sequence CCAGCGAATCTCATCACAGTA). Please visit https://doi.org/10.1101/2023.11.05.565677 for bioRxiv preprint.
Proper citation: RRID:Addgene_225460 Copy
Species: Homo sapiens
Genetic Insert: TDRD3
Vector Backbone Description: Backbone Marker:Mayr Lab; Vector Backbone:pcDNA3-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37961296
Comments: Please visit https://doi.org/10.1101/2023.11.05.565677 for bioRxiv preprint.
Proper citation: RRID:Addgene_225469 Copy
Species: Homo sapiens
Genetic Insert: NFKBIB
Vector Backbone Description: Backbone Size:6638; Vector Backbone:SFFV-MCS; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41539305
Comments: Barcode sequence cloned into XbaI restriction site. Design of plasmid is as follows: SFFV-[TF sequence]-WPRE-[Barcode sequence].
Proper citation: RRID:Addgene_219002 Copy
Species: Homo sapiens
Genetic Insert: TSC22D3
Vector Backbone Description: Backbone Size:6638; Vector Backbone:SFFV-MCS; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41539305
Comments: Barcode sequence cloned into XbaI restriction site. Design of plasmid is as follows: SFFV-[TF sequence]-WPRE-[Barcode sequence].
Proper citation: RRID:Addgene_219008 Copy
Species: Homo sapiens
Genetic Insert: eIF3D
Vector Backbone Description: Backbone Marker:Jonathan Weissman, Addgene plasmid #85996; Vector Backbone:pMJ179; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37144468
Proper citation: RRID:Addgene_222133 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
