Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: GFPuv
Vector Backbone Description: Backbone Marker:Lucigen; Vector Backbone:pSMART-HC-Kan; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32441815
Comments: Please visit https://www.biorxiv.org/content/10.1101/820787v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_127078 Copy
Vector Backbone Description: Vector Backbone:pLenti (Addgene #86708); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31626775
Comments: Cloning Method: Golden Gate; 3' Cloning Site: aagcaccgactcggtgccac
Please visit https://www.biorxiv.org/content/10.1101/383943v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_127173 Copy
Species: Homo sapiens
Genetic Insert: GFP-RelA
Vector Backbone Description: Vector Backbone:pLenti (Addgene #61427); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31626775
Comments: Cloning Site 3-prime: CCACATAGCGTAAAAGGAGC
Please visit https://www.biorxiv.org/content/10.1101/383943v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_127172 Copy
Genetic Insert: None
Vector Backbone Description: Vector Backbone:pLenti (Addgene #61427); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31626775
Comments: Cloning Method: Golden Gate; Cloning Site 3-prime: CCACATAGCGTAAAAGGAGC
Please visit https://www.biorxiv.org/content/10.1101/383943v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_127170 Copy
Vector Backbone Description: Vector Backbone:pLenti (Addgene #61427); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31626775
Comments: Cloning Method: Two-step Golden Gate; Cloning Site 3-prime: CCACATAGCGTAAAAGGAGC
Please visit https://www.biorxiv.org/content/10.1101/383943v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_127168 Copy
Species: Homo sapiens
Genetic Insert: MB21D1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4114; Vector Backbone:pRSFDuet; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31113940
Proper citation: RRID:Addgene_127161 Copy
Species: Mus musculus
Genetic Insert: Igkc
Vector Backbone Description: Backbone Size:5729; Vector Backbone:pUC19; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33268892
Comments: ENA accession: LR588433, https://www.ebi.ac.uk/ena/browser/view/LR588433
Proper citation: RRID:Addgene_127157 Copy
Species: Mus musculus
Genetic Insert: Iglc2
Vector Backbone Description: Backbone Size:5729; Vector Backbone:pUC19; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33268892
Comments: ENA accession: LR588434, https://www.ebi.ac.uk/ena/browser/view/LR588434
Proper citation: RRID:Addgene_127156 Copy
Genetic Insert: ChRger2-TS-EYFP
Vector Backbone Description: Backbone Size:5457; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31611694
Proper citation: RRID:Addgene_127239 Copy
Species: Other
Genetic Insert: Firefly luciferase
Vector Backbone Description: Backbone Size:6466; Vector Backbone:PB-CAG-GAPd2; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_127190 Copy
Species: Homo sapiens
Genetic Insert: FUS 1-163 S12xQ
Vector Backbone Description: Vector Backbone:RP1B; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31270472
Proper citation: RRID:Addgene_127193 Copy
Species: Homo sapiens
Genetic Insert: FUS 1-163
Vector Backbone Description: Vector Backbone:RP1B; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31270472
Proper citation: RRID:Addgene_127192 Copy
Species: A. tumefaciens
Genetic Insert: IPT
Vector Backbone Description: Backbone Marker:Cambia; Vector Backbone:pMOD_D4800EC; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31844292
Proper citation: RRID:Addgene_127229 Copy
Species: Maize
Genetic Insert: WUS2
Vector Backbone Description: Backbone Marker:Voytas Lab; Vector Backbone:pMOD_C'4800EC; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31844292
Proper citation: RRID:Addgene_127219 Copy
Species: Synthetic
Genetic Insert: ymScarletI
Vector Backbone Description: Vector Backbone:pFA6a; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30783202
Comments: Contains the linker region at the 5’ end of the FP, to use with the standard F5 forward primer (GGTGACGGTGCTGGTTTA).
Proper citation: RRID:Addgene_168055 Copy
Species: Synthetic
Genetic Insert: Blue light-inducible AraC dimers in Escherichia coli
Vector Backbone Description: Vector Backbone:pBAD33; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:33903769
Proper citation: RRID:Addgene_168050 Copy
Species: Homo sapiens
Genetic Insert: GFP-Flag-Nup62-EPEA
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5365; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33686291
Proper citation: RRID:Addgene_168101 Copy
Species: Peltigera membranacea cyanobiont 210A
Genetic Insert: PmcCAST minimal CRISPR array
Vector Backbone Description: Backbone Marker:Millipore Sigma; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:33770501
Proper citation: RRID:Addgene_168154 Copy
Species: Rattus norvegicus
Genetic Insert: frizzled-2
Vector Backbone Description: Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Xenopus Expression; Bacterial Resistance:Ampicillin
Comments: The original rat Frizzled-2 cDNA, tagged with a single epitope in the third extracellular loop (at an introduced NheI site) was cloned into CS2+. The CMV promoter was removed as a Sal-I-HindIII fragment, and the SV40 promoter fragment of the vector pCD-PS (as a Sal-I-SmaI fragment) was cloned in, destroying the HindIII site. As a result, this construct places the cDNA under the control of an SV40 promoter.
Reference: The untagged part of the insert was published by Wang et al., JBC 271: 4468 (1996). The myc-tagged insert was made by Jeff Brown, and the remainder of this unpublished construct was generated by Julia Yang-Snyder.
Proper citation: RRID:Addgene_16812 Copy
Species: Synthetic
Genetic Insert: PAM for AvCAST + AvPSP1
Vector Backbone Description: Vector Backbone:pACYC184; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:33770501
Proper citation: RRID:Addgene_168146 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
