Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: TALEsp1
Vector Backbone Description: Vector Backbone:unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:29553576
Proper citation: RRID:Addgene_109238 Copy
Species: Synthetic
Genetic Insert: TALEsp2
Vector Backbone Description: Vector Backbone:unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:29553576
Proper citation: RRID:Addgene_109239 Copy
Species: Other
Genetic Insert: zCas9
Vector Backbone Description: Vector Backbone:pYPQ167; Vector Types:Plant Expression, CRISPR, Gateway compatible zCas9 entry clone; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:29972722
Comments: pEGG-3_FLAG-NLS-zCas9-NLS cassette was originally from pHEE401E (Addgene plasmid#71287)
Proper citation: RRID:Addgene_109327 Copy
Species: Other
Genetic Insert: zCas9
Vector Backbone Description: Vector Backbone:pYPQ165; Vector Types:Plant Expression, CRISPR, Gateway compatible zCas9 entry clone; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:29972722
Comments: 3_FLAG-NLS-zCas9-NLS cassette was originally from pHEE401E (Addgene plasmid#71287)
Proper citation: RRID:Addgene_109328 Copy
Genetic Insert: N-29-1 split N-terminal T7 RNAP variant-linker-ZA expression plasmid
Vector Backbone Description: Vector Backbone:custom; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:28192413
Proper citation: RRID:Addgene_118085 Copy
Genetic Insert: N-29-1 split N-terminal T7 RNAP variant-GGSGSGSS-FRB expression plasmid
Vector Backbone Description: Vector Backbone:custom; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:28192413
Proper citation: RRID:Addgene_118087 Copy
Vector Backbone Description: Vector Backbone:pKFSS1_2; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:30315081
Comments: The use of Spectinomycin is recommended for propagation in E. coli and Streptomycin is recommended for propagation in B. burgdorferi. Please visit https://www.biorxiv.org/content/early/2018/09/21/363390 for bioRxiv preprint.
Proper citation: RRID:Addgene_118227 Copy
Species: Synthetic
Genetic Insert: dCasRx-RBM38
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR8/GW/TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:32532987
Comments: More info at http://CasFx.org . Please visit https://www.biorxiv.org/content/early/2018/09/30/431064 for bioRxiv preprint.
Proper citation: RRID:Addgene_118662 Copy
Species: Synthetic
Genetic Insert: DR-RG6-SA-DR
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR8/GW/TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:32532987
Comments: More info at http://CasFx.org . Please visit https://www.biorxiv.org/content/early/2018/09/30/431064 for bioRxiv preprint.
Proper citation: RRID:Addgene_118654 Copy
Species: Synthetic
Genetic Insert: gSMN2-EX
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR8/GW/TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:32532987
Comments: More info at http://CasFx.org . Please visit https://www.biorxiv.org/content/early/2018/09/30/431064 for bioRxiv preprint.
Proper citation: RRID:Addgene_118651 Copy
Species: Synthetic
Genetic Insert: RBFOX1N-dCasRx-C
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR8/GW/TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:32532987
Comments: More info at http://CasFx.org . Please visit https://www.biorxiv.org/content/early/2018/09/30/431064 for bioRxiv preprint.
Proper citation: RRID:Addgene_118657 Copy
Species: Synthetic
Genetic Insert: gSMN2-DN4
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR8/GW/TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:32532987
Comments: More info at http://CasFx.org . Please visit https://www.biorxiv.org/content/early/2018/09/30/431064 for bioRxiv preprint.
Proper citation: RRID:Addgene_118649 Copy
Species: Synthetic
Genetic Insert: gSMN2-DN3
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR8/GW/TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:32532987
Comments: More info at http://CasFx.org . Please visit https://www.biorxiv.org/content/early/2018/09/30/431064 for bioRxiv preprint.
Proper citation: RRID:Addgene_118648 Copy
Species: Arabidopsis thaliana
Genetic Insert: AT3G07200
Vector Backbone Description: Vector Backbone:pER8 cHA; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:28400782
Comments: 28 C in GV3101 (pMP90) strain
Our work is based on genomic approaches in Arabidopsis thaliana and groups of genes are presented in all of the following publications:
Pavicic Mirko (2019). Multifaceted roles of RING-type ubiquitin E3 ligases: reverse phenomic approaches. http://urn.fi/URN:ISBN:978-951-51-5483-5
Pavicic M., Mouhu K., Wang F., Bilicka M., Chovancek E., & Himanen K. (2017). Genomic and phenomic screens for flower related RING type ubiquitin E3 ligases in Arabidopsis. Frontiers in Plant Science. doi.org/10.3389/fpls.2017.00416
Pavicic M., Wang F., Mouhu K., Himanen K. (2019). High throughput in vitro seed germination screen identified new ABA responsive RING-type ubiquitin E3 ligases in Arabidopsis thaliana. Plant Cell Tissue and Organ Culture. https://link.springer.com/article/10.1007/s11240-019-01700-9
Proper citation: RRID:Addgene_118689 Copy
Species: Arabidopsis thaliana
Genetic Insert: XERICO
Vector Backbone Description: Vector Backbone:pER8 cHA; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:28400782
Comments: 28 C in GV3101 (pMP90) strain
Our work is based on genomic approaches in Arabidopsis thaliana and groups of genes are presented in all of the following publications:
Pavicic Mirko (2019). Multifaceted roles of RING-type ubiquitin E3 ligases: reverse phenomic approaches. http://urn.fi/URN:ISBN:978-951-51-5483-5
Pavicic M., Mouhu K., Wang F., Bilicka M., Chovancek E., & Himanen K. (2017). Genomic and phenomic screens for flower related RING type ubiquitin E3 ligases in Arabidopsis. Frontiers in Plant Science. doi.org/10.3389/fpls.2017.00416
Pavicic M., Wang F., Mouhu K., Himanen K. (2019). High throughput in vitro seed germination screen identified new ABA responsive RING-type ubiquitin E3 ligases in Arabidopsis thaliana. Plant Cell Tissue and Organ Culture. https://link.springer.com/article/10.1007/s11240-019-01700-9
Proper citation: RRID:Addgene_118690 Copy
Species: Arabidopsis thaliana
Genetic Insert: AT3G07200
Vector Backbone Description: Vector Backbone:pBA cHA; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:28400782
Comments: 28 C in GV3101 (pMP90) strain
Our work is based on genomic approaches in Arabidopsis thaliana and groups of genes are presented in all of the following publications:
Pavicic Mirko (2019). Multifaceted roles of RING-type ubiquitin E3 ligases: reverse phenomic approaches. http://urn.fi/URN:ISBN:978-951-51-5483-5
Pavicic M., Mouhu K., Wang F., Bilicka M., Chovancek E., & Himanen K. (2017). Genomic and phenomic screens for flower related RING type ubiquitin E3 ligases in Arabidopsis. Frontiers in Plant Science. doi.org/10.3389/fpls.2017.00416
Pavicic M., Wang F., Mouhu K., Himanen K. (2019). High throughput in vitro seed germination screen identified new ABA responsive RING-type ubiquitin E3 ligases in Arabidopsis thaliana. Plant Cell Tissue and Organ Culture. https://link.springer.com/article/10.1007/s11240-019-01700-9
Proper citation: RRID:Addgene_118665 Copy
Species: Homo sapiens
Genetic Insert: NRF2
Vector Backbone Description: Vector Backbone:pDNR223; Vector Types:Mammalian Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:27368101
Proper citation: RRID:Addgene_118708 Copy
Species: Arabidopsis thaliana
Genetic Insert: BPC4
Vector Backbone Description: Vector Backbone:pBA cMYC; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:28400782
Comments: 28 C in GV3101 (pMP90) strain
Our work is based on genomic approaches in Arabidopsis thaliana and groups of genes are presented in all of the following publications:
Pavicic Mirko (2019). Multifaceted roles of RING-type ubiquitin E3 ligases: reverse phenomic approaches. http://urn.fi/URN:ISBN:978-951-51-5483-5
Pavicic M., Mouhu K., Wang F., Bilicka M., Chovancek E., & Himanen K. (2017). Genomic and phenomic screens for flower related RING type ubiquitin E3 ligases in Arabidopsis. Frontiers in Plant Science. doi.org/10.3389/fpls.2017.00416
Pavicic M., Wang F., Mouhu K., Himanen K. (2019). High throughput in vitro seed germination screen identified new ABA responsive RING-type ubiquitin E3 ligases in Arabidopsis thaliana. Plant Cell Tissue and Organ Culture. https://link.springer.com/article/10.1007/s11240-019-01700-9
Proper citation: RRID:Addgene_118668 Copy
Species: Homo sapiens
Genetic Insert: SLC7A11
Vector Backbone Description: Vector Backbone:pDNR223; Vector Types:Mammalian Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:27368101
Comments: pDONR223 SLC7A11 insensitive to hairpin TRCN0000288926 (target sequence: CCCTGGAGTTATGCAGCTAAT). Mutated cDNA sequence (GCCCGGCGTGATGCAATTGAT) was confirmed by DNA sequencing,
Proper citation: RRID:Addgene_118701 Copy
Species: Synthetic
Genetic Insert: J23102MH
Vector Backbone Description: Backbone Size:2247; Vector Backbone:PICH41295; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:30819783
Comments: Please visit https://www.biorxiv.org/content/10.1101/426700v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_119577 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
