Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: mouse MSI1 (FL)
Vector Backbone Description: Backbone Marker:System Biosciences; Backbone Size:8300; Vector Backbone:pCDH-CMV-MCS-EF1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24935936
Proper citation: RRID:Addgene_60358 Copy
Species: Mus musculus
Genetic Insert: mouse MSI1 (7-192)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pET-22b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24935936
Proper citation: RRID:Addgene_60353 Copy
Species: Mus musculus
Genetic Insert: mouse MSI1 (7-192)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pET-22b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24935936
Proper citation: RRID:Addgene_60351 Copy
Species: Mus musculus
Genetic Insert: Kcnj2
Vector Backbone Description: Backbone Size:5008; Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25043046
Proper citation: RRID:Addgene_60644 Copy
Species: Mus musculus
Genetic Insert: Flpo
Vector Backbone Description: Backbone Size:4326; Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25043046
Proper citation: RRID:Addgene_60662 Copy
Species: Mus musculus
Genetic Insert: Pitx2
Vector Backbone Description: Backbone Marker:Thomson lab; Backbone Size:4182; Vector Backbone:pBTO-Dest; Vector Types:Mammalian Expression, PiggyBac; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25458896
Proper citation: RRID:Addgene_60668 Copy
Species: Mus musculus
Genetic Insert: VP64 mouse MyoD
Vector Backbone Description: Backbone Size:10000; Vector Backbone:pRRL; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25494287
Proper citation: RRID:Addgene_60625 Copy
Species: Mus musculus
Genetic Insert: p65 mouse MyoD
Vector Backbone Description: Backbone Size:10000; Vector Backbone:pRRL; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25494287
Proper citation: RRID:Addgene_60627 Copy
Species: Mus musculus
Genetic Insert: VP16 mouse MyoD
Vector Backbone Description: Backbone Size:10000; Vector Backbone:pRRL; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25494287
Proper citation: RRID:Addgene_60626 Copy
Species: Mus musculus
Genetic Insert: NrasG12D
Vector Backbone Description: Backbone Marker:Clonetech; Vector Backbone:MSCV; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19339691
Proper citation: RRID:Addgene_60834 Copy
Species: Mus musculus
Genetic Insert: Ten-Eleven Translocation 1
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3*; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24412366
Comments: *modified pcDNA3 vector with a beta globulin intron inserted. This insertion can help stabilize the transcripts and is particularly useful for the expression of large genes, such as p300 and Tet proteins
Proper citation: RRID:Addgene_60938 Copy
Species: Mus musculus
Genetic Insert: mouse BIN1 with exon 13, excluding exon 7, 11, 14-17
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:8123; Vector Backbone:pDEST27; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24836577
Proper citation: RRID:Addgene_61087 Copy
Species: Mus musculus
Genetic Insert: mouse BIN1 with exon 13 and 17, excluding exon 7, 11, 14-16
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:8123; Vector Backbone:pDEST27; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24836577
Proper citation: RRID:Addgene_61097 Copy
Species: Mus musculus
Genetic Insert: Ngn3
Vector Backbone Description: Backbone Marker:lifetechnologies; Backbone Size:36686; Vector Backbone:pAd CMV/V5-DEST; Vector Types:Adenoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25402613
Comments: For more information, please see the associated article (Li, et al., Nat Biotechnol. 2014 PMID: 25402613.), as well as Li, et al., eLife. 2014, PMID: 24714494.
Note: The plasmid contains an N103Y amino acid residue substitution in the mouse Pdx1 gene. This residue change was present in the depositor's original plasmid stock as described in the associated publication and and should not affect plasmid function.
Proper citation: RRID:Addgene_61041 Copy
Species: Mus musculus
Genetic Insert: DIXDC1
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pDONR221; Vector Types:DONR clone (Gateway); Bacterial Resistance:Kanamycin
Defining Citation: PMID:25042806
Proper citation: RRID:Addgene_61216 Copy
Species: Mus musculus
Genetic Insert: IL-6 promoter
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGL2 basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12626566
Comments: Contains point mutations in C/EBP binding site. See Table 1 of associated publication for more details.
Full sequence and map is available for wild-type vector pmIL-6 FL (Plasmid #61290)
Proper citation: RRID:Addgene_61291 Copy
Species: Mus musculus
Genetic Insert: IL-6 promoter
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGL2 basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12626566
Comments: Contains point mutations in NF-kB binding site. See Table 1 of associated publication for more details.
Full sequence and map is available for wild-type vector pmIL-6 FL (Plasmid #61290)
Proper citation: RRID:Addgene_61293 Copy
Species: Mus musculus
Genetic Insert: Dixdc1
Vector Backbone Description: Backbone Marker:Eric Campeau; Vector Backbone:pENTR/pTER+; Vector Types:ENTR clone; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25042806
Proper citation: RRID:Addgene_61236 Copy
Species: Mus musculus
Genetic Insert: Truncated IL-6 promoter
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGL2 basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12626566
Comments: Full sequence and map is available for wild-type vector pmIL-6 FL (Plasmid #61290). See publication for details of 5' sequence removed.
Proper citation: RRID:Addgene_61287 Copy
Species: Mus musculus
Genetic Insert: gcggcagctcctagctcagc
Vector Backbone Description: Vector Backbone:px335; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25569111
Proper citation: RRID:Addgene_61515 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.