Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Authority:addgene (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

178,636 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pcDNA3.2 mir-1-1 reporter mir50-4
 
Resource Report
Resource Website
RRID:Addgene_46713 mir50-4 Caenorhabditis elegans Ampicillin PMID:23415231 Backbone Marker:Bartel lab (Addgene plasmid# 46646); Backbone Size:8038; Vector Backbone:pcDNA3.2 V5-DEST mir-1-1 reporter; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin see sequence and publication 2026-09-01 09:55:34 0
pcDNA3.2 mir-1-1 reporter hsa-mir-138-2
 
Resource Report
Resource Website
RRID:Addgene_46677 hsa-mir-138-2 Homo sapiens Ampicillin PMID:23415231 Backbone Marker:Bartel lab (Addgene plasmid# 46646); Backbone Size:8038; Vector Backbone:pcDNA3.2 V5-DEST mir-1-1 reporter; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin 2026-09-01 09:55:33 0
pcDNA3.2 mir-1-1 reporter hsa-mir-142
 
Resource Report
Resource Website
RRID:Addgene_46678 hsa-mir-142 Homo sapiens Ampicillin PMID:23415231 Backbone Marker:Bartel lab (Addgene plasmid# 46646); Backbone Size:8038; Vector Backbone:pcDNA3.2 V5-DEST mir-1-1 reporter; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin 2026-09-01 09:55:33 0
pcDNA3.2 mir-1-1 reporter mir50-2
 
Resource Report
Resource Website
RRID:Addgene_46711 mir50-2 Caenorhabditis elegans Ampicillin PMID:23415231 Backbone Marker:Bartel lab (Addgene plasmid# 46646); Backbone Size:8038; Vector Backbone:pcDNA3.2 V5-DEST mir-1-1 reporter; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin see sequence and publication 2026-09-01 09:55:34 0
pcDNA3.2 mir-1-1 reporter hsa-let-7a-1
 
Resource Report
Resource Website
RRID:Addgene_46670 hsa-let-7a-1 Homo sapiens Ampicillin PMID:23415231 Backbone Marker:Bartel lab (Addgene plasmid# 46646); Backbone Size:8038; Vector Backbone:pcDNA3.2 V5-DEST mir-1-1 reporter; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin 2026-09-01 09:55:33 0
pcDNA3.2 mir-1-1 reporter mir44-2
 
Resource Report
Resource Website
RRID:Addgene_46705 mir44-2 Caenorhabditis elegans Ampicillin PMID:23415231 Backbone Marker:Bartel lab (Addgene plasmid# 46646); Backbone Size:8038; Vector Backbone:pcDNA3.2 V5-DEST mir-1-1 reporter; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin see sequence and publication 2026-09-01 09:55:34 0
pcDNA3.2 mir-1-1 reporter mir44-3
 
Resource Report
Resource Website
RRID:Addgene_46706 mir44-3 Caenorhabditis elegans Ampicillin PMID:23415231 Backbone Marker:Bartel lab (Addgene plasmid# 46646); Backbone Size:8038; Vector Backbone:pcDNA3.2 V5-DEST mir-1-1 reporter; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin see sequence and publication 2026-09-01 09:55:34 0
pcDNA3.2 mir-1-1 reporter mir44-1
 
Resource Report
Resource Website
RRID:Addgene_46704 mir44-1 Caenorhabditis elegans Ampicillin PMID:23415231 Backbone Marker:Bartel lab (Addgene plasmid# 46646); Backbone Size:8038; Vector Backbone:pcDNA3.2 V5-DEST mir-1-1 reporter; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin see sequence and publication 2026-09-01 09:55:34 0
pcDNA3.2 mir-1-1 reporter mir44-4
 
Resource Report
Resource Website
RRID:Addgene_46707 mir44-4 Caenorhabditis elegans Ampicillin PMID:23415231 Backbone Marker:Bartel lab (Addgene plasmid# 46646); Backbone Size:8038; Vector Backbone:pcDNA3.2 V5-DEST mir-1-1 reporter; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin see sequence and publication 2026-09-01 09:55:34 0
pcDNA3.2 mir-1-1 reporter mir44-5
 
Resource Report
Resource Website
RRID:Addgene_46708 mir44-5 Caenorhabditis elegans Ampicillin PMID:23415231 Backbone Marker:Bartel lab (Addgene plasmid# 46646); Backbone Size:8038; Vector Backbone:pcDNA3.2 V5-DEST mir-1-1 reporter; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin see sequence and publication 2026-09-01 09:55:34 0
pcDNA3.2 mir-1-1 reporter dme-mir-2a-1
 
Resource Report
Resource Website
RRID:Addgene_46664 dme-mir-2a-1 Drosophila melanogaster Ampicillin PMID:23415231 Backbone Marker:Bartel lab (Addgene plasmid# 46646); Backbone Size:8038; Vector Backbone:pcDNA3.2 V5-DEST mir-1-1 reporter; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin 2026-09-01 09:55:33 0
pcDNA3.2 mir-1-1 reporter dme-let-7
 
Resource Report
Resource Website
RRID:Addgene_46662 dme-let-7 Drosophila melanogaster Ampicillin PMID:23415231 Backbone Marker:Bartel lab (Addgene plasmid# 46646); Backbone Size:8038; Vector Backbone:pcDNA3.2 V5-DEST mir-1-1 reporter; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin 2026-09-01 09:55:33 0
pcDNA3.2 mir-1-1 reporter mir40-7
 
Resource Report
Resource Website
RRID:Addgene_46702 mir40-7 Caenorhabditis elegans Ampicillin PMID:23415231 Backbone Marker:Bartel lab (Addgene plasmid# 46646); Backbone Size:8038; Vector Backbone:pcDNA3.2 V5-DEST mir-1-1 reporter; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin see sequence and publication 2026-09-01 09:55:34 0
pcDNA3.2 mir-1-1 reporter dme-mir-125
 
Resource Report
Resource Website
RRID:Addgene_46667 dme-mir-125 Drosophila melanogaster Ampicillin PMID:23415231 Backbone Marker:Bartel lab (Addgene plasmid# 46646); Backbone Size:8038; Vector Backbone:pcDNA3.2 V5-DEST mir-1-1 reporter; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin 2026-09-01 09:55:33 0
pcDNA3.2 mir-1-1 reporter mir40-5
 
Resource Report
Resource Website
RRID:Addgene_46700 mir40-5 Caenorhabditis elegans Ampicillin PMID:23415231 Backbone Marker:Bartel lab (Addgene plasmid# 46646); Backbone Size:8038; Vector Backbone:pcDNA3.2 V5-DEST mir-1-1 reporter; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin see sequence and publication 2026-09-01 09:55:34 0
BDD FVIII H4
 
Resource Report
Resource Website
RRID:Addgene_46774 B-domain deleted FVIII H4 (R484H) Homo sapiens Ampicillin Polymorphisms described in: Inhibitors of factor VIII in black patients with hemophilia. Viel KR, Ameri A, Abshire TC, Iyer RV, Watts RG, Lutcher C, Channell C, Cole SA, Fernstrom KM, Nakaya S, Kasper CK, Thompson AR, Almasy L, Howard TE. N Engl J Med. 2009 Apr 16;360(16):1618-27. doi: 10.1056/NEJMoa075760. Erratum in: N Engl J Med. 2009 Jul 30;361(5):544. PMID:1936966 Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pcDNA4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin R484H 2026-09-01 09:55:35 0
FVIII H2
 
Resource Report
Resource Website
RRID:Addgene_46773 full length FVIII D1241E Homo sapiens Ampicillin Polymorphisms described in: Inhibitors of factor VIII in black patients with hemophilia. Viel KR, Ameri A, Abshire TC, Iyer RV, Watts RG, Lutcher C, Channell C, Cole SA, Fernstrom KM, Nakaya S, Kasper CK, Thompson AR, Almasy L, Howard TE. N Engl J Med. 2009 Apr 16;360(16):1618-27. doi: 10.1056/NEJMoa075760. Erratum in: N Engl J Med. 2009 Jul 30;361(5):544. PMID:1936966 Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pcDNA4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin D1241E 2026-09-01 09:55:35 0
pcDNA3.2 mir-1-1 reporter cel-mir-59
 
Resource Report
Resource Website
RRID:Addgene_46657 cel-mir-59 Caenorhabditis elegans Ampicillin PMID:23415231 Backbone Marker:Bartel lab (Addgene plasmid# 46646); Backbone Size:8038; Vector Backbone:pcDNA3.2 V5-DEST mir-1-1 reporter; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin 2026-09-01 09:55:33 0
PCMV-intron myc Rab1aWT
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46776 Rab1a Homo sapiens Ampicillin PMID:16959776 cDNA was obtained from UMR cDNA Resource Center, www.cdna.org . Also see Dupré et al., 2006 Cell Signal. 2007 Mar;19(3):481-9. https://www.ncbi.nlm.nih.gov/pubmed/16979872 for more information. Vector Backbone:pCMV-intron myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:55:35 4
PCMV-intron myc Rab1a S25N
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46777 Rab1a S25N mutant Homo sapiens Ampicillin PMID:16959776 cDNA was obtained from UMR cDNA Resource Center, www.cdna.org To make mutation, the following primers were used for PCR amplification: Rab1 S25N FWD (5′-AGCTCGGATCCACCATGTCCAGCATGAATCCCGAATATGATTATTTATTCAAGTTACTTCTGATTGGCGACTCAGGGGTTGGAAAGAATTGCCTTCTTCT-3′) BGH RVS primer (5′-TAGAAGGCACAGTCGAGG-3′) Vector Backbone:pCMV-intron myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin S25N (dominant negative) 2026-09-01 09:55:35 2

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.