Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Bacterial Resistance:kanamycin (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

33,912 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
p-mCherry-C1-Phobos
 
Resource Report
Resource Website
RRID:Addgene_98166 Synthetic construct Phobos gene Synthetic Kanamycin PMID:29097684 Backbone Size:4708; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin T59S, E83N, E90Q, E101S, V117R, E123S, T159G, G163A, V242R, T246N, N258Q, E273S 2026-08-29 01:13:14 0
p-mCherry-C1-iC++_CA
 
Resource Report
Resource Website
RRID:Addgene_98168 Synthetic construct iC++_C128A gene Synthetic Kanamycin PMID:29097684 Backbone Size:4708; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin T59S, E83N, E90Q, E101S, V117R, E123S, C128A, V242R, T246N, N258Q, E273S 2026-08-29 01:13:14 0
p-mCherry-C1-Aurora_CA
 
Resource Report
Resource Website
RRID:Addgene_98170 Synthetic construct Aurora_C128A gene Synthetic Kanamycin PMID:29097684 Backbone Size:4714; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin V59S, E83N, E90Q, E101S, V117R, E123S, C128A, P242R, A246N, N258Q, E273S 2026-08-29 01:13:14 0
p-mCherry-C1-iChR2++
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_98172 Synthetic construct iChR2++ gene Synthetic Kanamycin PMID:29097684 Backbone Size:4714; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin A59S, E83N, E90Q, E101S, Q117R, E123S, T159C, V242R, T246N, N258Q, E273S 2026-08-29 01:13:15 1
p-mCherry-N1-iChloC_CA
 
Resource Report
Resource Website
RRID:Addgene_98171 Synthetic construct iChloC_C128A gene Synthetic Kanamycin PMID:29097684 Modifications to backbone: EGFP has been replaced by inserting the complete fusion construct (ChR2-mCherry) using XbaI and BamHI cloning sites. Backbone Size:4733; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin E83Q, E90R, E101S, C128A, T159C, D156N 2026-08-29 01:13:14 0
pmEos2-Linker_PCNA-MutC
 
Resource Report
Resource Website
RRID:Addgene_98272 PCNA Homo sapiens Kanamycin PMID:26758689 Plasmid encodes a second insert: mEos2 (from Lobophyllia hemprichii). A glycine-rich linker sequence (GEGQGQGQGPGRGYAYRS), which was reported to be necessary for cell line generation, was inserted as a spacer between mEos2 and PCNA. Backbone Marker:Clontech; Vector Backbone:C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Silent mutated Sequence: GACGCCGTAGTTATATCTTGC (Original: GATGCTGTTGTAATTTCCTGT) 2026-08-29 01:13:15 0
pDpsTE-Ypet
 
Resource Report
Resource Website
RRID:Addgene_98277 Dps Other Kanamycin PMID:26289028 Ypet = fast maturing YFP variant Backbone Marker:Clontech; Vector Backbone:plasmid PAtagRFP-actin (Verkhusha lab/Addgene); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-29 01:13:15 0
IPCEF1 (PIP3EA-c002)
 
Resource Report
Resource Website
RRID:Addgene_98240 PIP3EA Homo sapiens Kanamycin Use BL21(DE3)-R3-pRARE2 for expression. T7/lac regulated, N-terminal His-tag, TEV, LIC cloning using BsaI cleavage/T4 polymerase, SacB stuffer fragment, pET28 backbone. 5MR1: http://www.thesgc.org/structures/5MR1 Backbone Marker:Opher Gileadi (Addgene plasmid # 26103); Vector Backbone:pNIC28-Bsa4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-29 01:13:16 0
SND1 (SND1A-c003)
 
Resource Report
Resource Website
RRID:Addgene_98242 SND1A Homo sapiens Kanamycin Use BL21(DE3)-R3-pRARE2 for expression. T7/lac regulated, N-terminal His-tag, TEV, LIC cloning using BsaI cleavage/T4 polymerase, SacB stuffer fragment, pET28 backbone. 5M9O: http://www.thesgc.org/structures/5M9O Backbone Marker:Opher Gileadi (Addgene plasmid # 26103); Vector Backbone:pNIC28-Bsa4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin pfam00567:TUDOR 677-799 2026-08-29 01:13:15 0
ZMYND8 (PRKCBP1A-c097)
 
Resource Report
Resource Website
RRID:Addgene_98244 PRKCBP1A Homo sapiens Kanamycin Use BL21(DE3)-R3-pRARE2 for expression. Z-Basic solubility-enhancing tag, normal LIC cloning, TEV cleavage. Pavel EXP-09-AC5269. 5MQ4: http://www.thesgc.org/structures/5MQ4 Backbone Marker:Opher Gileadi (Addgene plasmid # 26107); Vector Backbone:pNIC-ZB; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-29 01:13:15 0
BRD7 (BRD7A-c005)
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_98245 BRD7A Homo sapiens Kanamycin Use BL21(DE3)-R3-pRARE2 for expression. T7/lac regulated, N-terminal His-tag, TEV, LIC cloning using BsaI cleavage/T4 polymerase, SacB stuffer fragment, pET28 backbone. 5MQ1: http://www.thesgc.org/structures/5MQ1 Backbone Marker:Opher Gileadi (Addgene plasmid # 26103); Vector Backbone:pNIC28-Bsa4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin pfam00439:Bromodomain 136-223 2026-08-29 01:13:15 2
pSNAP-FtnA
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_98282 FtnA Other Kanamycin PMID:26289028 Backbone Marker:Clontech; Vector Backbone:plasmid PAtagRFP-actin (Verkhusha lab/Addgene); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-29 01:13:15 1
pmEOS2-VSVG
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_98286 VSVG Other Kanamycin PMID:26358640 Vector Backbone:pPAGFP-VSVG ; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-29 01:13:15 4
BB1_12_pPDC1
 
Resource Report
Resource Website
RRID:Addgene_98501 PDC1 promoter Other Kanamycin PMID:29221460 Backbone Size:1936; Vector Backbone:BB1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin Internal BsaI and BpiI sites removed from insert 2026-08-29 01:13:17 0
BB1_12_pRPP1B
 
Resource Report
Resource Website
RRID:Addgene_98500 RPP1B promoter Other Kanamycin PMID:29221460 Backbone Size:1936; Vector Backbone:BB1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin Internal BsaI and BpiI sites removed from insert 2026-08-29 01:13:17 0
BB1_12_pADH2
 
Resource Report
Resource Website
RRID:Addgene_98504 ADH2 promoter Other Kanamycin PMID:29221460 Backbone Size:1936; Vector Backbone:BB1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin Internal BsaI and BpiI sites removed from insert 2026-08-29 01:13:17 0
BB1_12_pTEF2
 
Resource Report
Resource Website
RRID:Addgene_98507 TEF2 promoter Other Kanamycin PMID:29221460 Backbone Size:1936; Vector Backbone:BB1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin Internal BsaI and BpiI sites removed from insert 2026-08-29 01:13:17 0
BB1_12_pSHB17
 
Resource Report
Resource Website
RRID:Addgene_98506 SHB17 promoter Other Kanamycin PMID:29221460 Backbone Size:1936; Vector Backbone:BB1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin Internal BsaI and BpiI sites removed from insert 2026-08-29 01:13:17 0
BB1_12_pPFK300
 
Resource Report
Resource Website
RRID:Addgene_98510 PpPfk promoter Other Kanamycin PMID:29221460 Backbone Size:1936; Vector Backbone:BB1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin Internal BsaI and BpiI sites removed from insert 2026-08-29 01:13:17 0
BB1_12_pTHI11
 
Resource Report
Resource Website
RRID:Addgene_98512 THI11 promoter Other Kanamycin PMID:29221460 Backbone Size:1936; Vector Backbone:BB1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin Internal BsaI and BpiI sites removed from insert 2026-08-29 01:13:17 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.