Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Rattus norvegicus
Genetic Insert: Homer1
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mEos2-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 505 / 569; Emission = 516 / 581
Proper citation: RRID:Addgene_57388 Copy
Species: Rattus norvegicus
Genetic Insert: LAMP1
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mEos2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19169260
Comments: . Excitation = 505 / 569; Emission = 516 / 581
Proper citation: RRID:Addgene_57397 Copy
Species: Rattus norvegicus
Genetic Insert: LAMP1
Vector Backbone Description: Backbone Size:4750; Vector Backbone:Kaede; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 508 / 572; Emission = 518 / 580
Proper citation: RRID:Addgene_57318 Copy
Species: Rattus norvegicus
Genetic Insert: PSD95
Vector Backbone Description: Backbone Size:4750; Vector Backbone:Dronpa-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 503; Emission = 518
Proper citation: RRID:Addgene_57293 Copy
Species: Rattus norvegicus
Genetic Insert: PSD95
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mEos3.2-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 507 / 572; Emission = 516 / 580
Proper citation: RRID:Addgene_57480 Copy
Species: Rattus norvegicus
Genetic Insert: Cx43
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mEos4a; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: R. norvegicus (rat) Alpha-1 Connexin 43. Excitation = 505 / 569; Emission = 516 / 581
Proper citation: RRID:Addgene_57492 Copy
Species: Rattus norvegicus
Genetic Insert: Homer1
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mEos3.2-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 507 / 572; Emission = 516 / 580
Proper citation: RRID:Addgene_57460 Copy
Species: Rattus norvegicus
Genetic Insert: rM3D-mCherry
Vector Backbone Description: Backbone Size:4818; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Comments: These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community.
Proper citation: RRID:Addgene_50458 Copy
Species: Rattus norvegicus
Genetic Insert: mRuby2-P2A-GCaMP6m
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27284193
Comments: The discrepancies between the full sequence and Addgene's QC sequence should not have any functional consequence.
Proper citation: RRID:Addgene_51473 Copy
Species: Rattus norvegicus
Genetic Insert: AP180
Vector Backbone Description: Vector Backbone:pQE-31; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7814377
Proper citation: RRID:Addgene_63006 Copy
Species: Rattus norvegicus
Genetic Insert: Epsin 1 without ENTH domain
Vector Backbone Description: Backbone Marker:Qiagen; Vector Backbone:pQE-32; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11756460
Proper citation: RRID:Addgene_63008 Copy
Species: Rattus norvegicus
Genetic Insert: Endolyn
Vector Backbone Description: Backbone Marker:Girotti and Banting, PMID 9013339 ; Vector Backbone:delta pMEP4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10620506
Proper citation: RRID:Addgene_62962 Copy
Species: Rattus norvegicus
Genetic Insert: lgp120
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: The 10 amino acid linker was designed using the sequence as described below but with different cloning sites (EcoRI and BamHI):
Patterson GH and Lippincott-Schwartz J. (2002) A Photoactivatable GFP for Selective Photolabeling of Proteins and Cells. Science 297, 1873-1877.
Examples of use:
Jahreiss L, Menzies FM, Rubinsztein DC. (2008) The itinerary of autophagosomes: from peripheral formation to kiss-and-run fusion with lysosomes. Traffic 9: 574-587.
Renna M, Schaffner C, Winslow AR, Menzies FM, Peden AA, Floto RA, Rubinsztein DC. (2011) Autophagic substrate clearance requires activity of the syntaxin-5 SNARE complex. J Cell Sci 124:469-482.
Ogunbayo OA, Zhu Y, Shen B, Agban E, Li J, Ma J, Zhu MX, Evans AM. (2015) Organelle-specific Subunit Interactions of the Vertebrate Two-pore Channel Family. J. Biol. Chem. 290: 1086-1095.
Proper citation: RRID:Addgene_62963 Copy
Species: Rattus norvegicus
Genetic Insert: Syntaxin 1A
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pECFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23536066
Proper citation: RRID:Addgene_53236 Copy
Species: Rattus norvegicus
Genetic Insert: VAMP2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pECFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23536066
Proper citation: RRID:Addgene_53233 Copy
Species: Rattus norvegicus
Genetic Insert: clathrin light chain
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23103167
Proper citation: RRID:Addgene_53972 Copy
Species: Rattus norvegicus
Genetic Insert: CLIP-170 CAP-Gly
Vector Backbone Description: Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:41662400
Proper citation: RRID:Addgene_255801 Copy
Species: Rattus norvegicus
Genetic Insert: Omp25
Vector Backbone Description: Backbone Size:6101; Vector Backbone:pMRX-IPU; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39288101
Proper citation: RRID:Addgene_228137 Copy
Species: Rattus norvegicus
Genetic Insert: LAP2b
Vector Backbone Description: Vector Backbone:n/a; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37098350
Proper citation: RRID:Addgene_228029 Copy
Species: Rattus norvegicus
Genetic Insert: CRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG)
Vector Backbone Description: Backbone Marker:Dr Konstantin Kogan; Backbone Size:14900; Vector Backbone:pLV-hUV6-sgRNA-dCas9-KRAB-TagBFP; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37226896
Proper citation: RRID:Addgene_202556 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
