Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Bacterial Resistance:ampicillin (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

328,630 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pIRES-Ap2a2-FKBP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46944 Ap2a2-FKBP Homo sapiens Ampicillin PMID:20159602 Backbone Marker:Clontech; Vector Backbone:pIRESneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 1
pCVL.SSA TLR (CCR5 TALEN Sce Spacer)
 
Resource Report
Resource Website
RRID:Addgene_46941 5' iRFP arm Ampicillin PMID:24121685 Backbone Size:5065; Vector Backbone:pCVL; Vector Types:Mammalian Expression, Bacterial Expression, Lentiviral; Bacterial Resistance:Ampicillin truncated 38 amino acids from C terminus 2026-08-15 01:15:37 0
pcDNA-f:PGC1-3D
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_47 PGC-1a Mus musculus Ampicillin PMID:14744933 Please see Addgene plasmid 1026 (pcDNA-f:PGC1) for wildtype sequence and map. Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1 myc-His A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Amino acids 262, 265, and 298 have been changed to aspartic acid 2026-08-15 01:15:37 6
pINDUCER13 (miR-LUP)
 
Resource Report
Resource Website
RRID:Addgene_46936 PheS Gly294 P. haloplanktis Ampicillin PMID:21307310 Backbone Marker:Open Biosystems; Backbone Size:11688; Vector Backbone:GIPZ; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 0
pRK5-HA-SH3BP4 W92A
 
Resource Report
Resource Website
RRID:Addgene_46893 SH3BP4 W92A Homo sapiens Ampicillin PMID:22575674 Mutagenesis was performed using a site-directed mutagenesis kit (Stratagene) and the following primer: cacatctggcggtgaggcgtggtacgcacacaac Backbone Marker:clonetch; Vector Backbone:pRK5-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin W92A (mutated SH3 domain) 2026-08-15 01:15:36 0
LZRSMS-GFP-hFJX1-Myc
 
Resource Report
Resource Website
RRID:Addgene_46932 FJX1 Homo sapiens Ampicillin Backbone Size:12800; Vector Backbone:LZRS-MS-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 0
pcDNA-zeo-hFJX1-myc
 
Resource Report
Resource Website
RRID:Addgene_46930 FJX1 Homo sapiens Ampicillin Backbone Marker:Invitrogen; Backbone Size:5015; Vector Backbone:pcDNA3.1/Zeo(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:37 0
5HRE/GFP
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_46926 5X HRE of VEGF Homo sapiens Ampicillin PMID:11774035 The 35-bp human VEGF HRE sequence is: CCACAGTGCATACGTGGGCTCCAACAGGTCCTCTT The d2EGFP fragment was amplified from a Clontech (Palo Alto, CA) vector and encodes a destabilized red- shifted variant of wild-type GFP with an excitation maximum of 488 nm, an emission maximum of 507 nm, and a half-life of approximately 2 hours. Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pEF/myc/cyto; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin five copies of a 35-bp fragment from the hypoxia-responsive element (HRE) of the human VEGF gene and a human cytomegalovirus minimal promoter 2026-08-15 01:15:37 24
pSNR52-sgTET
 
Resource Report
Resource Website
RRID:Addgene_46923 sgRNA targeting endogenous TRE elements of pTET07 promoter Saccharomyces cerevisiae Ampicillin PMID:23849981 gRNA target sequence TATCAGTGATAGAGAAAAGT Backbone Size:5083; Vector Backbone:AH057; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 0
LZRSMS-GFP-hFJX1-Flag
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46929 FJX1 Homo sapiens Ampicillin Backbone Size:12800; Vector Backbone:LZRS-MS-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 1
pIRES-GFP-hFJX1-myc
 
Resource Report
Resource Website
RRID:Addgene_46928 FJX1 Homo sapiens Ampicillin A 5' EcoRI site and 3' myc tag were added to the FJX1 cDNA by PCR. The fragment was blunt end ligated into an EcoRV site on pIRES-EGFP so there is an additional EcoRI site at 5' end of FJX1. Backbone Marker:Clontech; Backbone Size:5200; Vector Backbone:pIRES-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 0
pMA3288
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46885 Uracil-N-glycosylase WT Homo sapiens Ampicillin PMID:23721969 Backbone Marker:Homemade; Backbone Size:6686; Vector Backbone:pMA2780; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 1
pTDH3-dCas9
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46920 dCas9 Ampicillin PMID:23849981 The Cas9 contains a N612K mutation that does not effect the function of the enzyme. Backbone Size:6900; Vector Backbone:pJED103; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 7
pMA3174
 
Resource Report
Resource Website
RRID:Addgene_46880 Ampicillin PMID:22637478 Backbone Marker:Homemade; Backbone Size:6990; Vector Backbone:pMA3211; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 0
pU6-sgGFP-NT1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46914 sgGFP-NT1 Ampicillin PMID:23849981 gRNA target sequence GAATAGCTCAGAGGCCGAGG Backbone Marker:Addgene; Backbone Size:8200; Vector Backbone:pSICO derivative; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 8
pU6-sgGAL4-1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46915 sgGAL4-1 Ampicillin PMID:23849981 gRNA target sequence GTTGGAGCACTGTCCTCCGAACGT Backbone Marker:Addgene; Backbone Size:8200; Vector Backbone:pSICO derivative; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 2
pMA3211
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46879 Ampicillin PMID:22637478 Backbone Marker:Homemade; Backbone Size:6642; Vector Backbone:pMA3211; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 1
pMSCV-LTR-dCas9-p65AD-BFP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46913 dCas9-p65AD-BFP fusion Homo sapiens Ampicillin PMID:23849981 Backbone Marker:Clontech; Backbone Size:6300; Vector Backbone:MSCV-puro; Vector Types:Mammalian Expression, Retroviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:37 2
pU6-sgCD71-2
 
Resource Report
Resource Website
RRID:Addgene_46918 sgCD71 -2 Homo sapiens Ampicillin PMID:23849981 gRNA target sequence GGACGCGCTAGTGTGAGTGC Backbone Marker:Addgene; Backbone Size:8200; Vector Backbone:pSICO derivative; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:36 0
pU6-sgGAL4-4
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_46916 sgGAL4-4 Ampicillin PMID:23849981 gRNA target sequence GAACGACTAGTTAGGCGTGTA Backbone Marker:Addgene; Backbone Size:8200; Vector Backbone:pSICO derivative; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:15:37 1

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.