Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pRRG1014-LDLRR-3 Resource Report Resource Website |
RRID:Addgene_99095 | LDLRR-3 in situ probe | Schmidtea mediterranea | Ampicillin and Kanamycin | PMID:27612384 | Cloning primers: F-GATGTTTAGACCATAGTATATG, R-GAATTGAAGATAAAATAAATTG | Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:44 | 0 | |
|
pRRG142-Arrowhead Resource Report Resource Website |
RRID:Addgene_99097 | Arrowhead in situ probe | Schmidtea mediterranea | Ampicillin and Kanamycin | PMID:27612384 | Cloning primers: F-TTGATGGAAAGTGTTTTGGTTG, R-TTTTCAGTTTTCCCGTTACAAA | Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:43 | 0 | |
|
pCRISPR01-FnCpf1 Resource Report Resource Website |
RRID:Addgene_176529 | FnCpf1 | Synthetic | Ampicillin and Kanamycin | PMID:33573639 | Backbone Marker:Uffe Mortensen (Addgene plasmid # 87844); Vector Backbone:pFC333; Vector Types:CRISPR, Fungal Expression; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:57 | 0 | ||
|
pRRG581-FLI1 Resource Report Resource Website |
RRID:Addgene_99099 | FLI-1 in situ probe | Schmidtea mediterranea | Ampicillin and Kanamycin | PMID:27612384 | Cloning primers: F-CGGACTTGGACTATCGGAAA, R-CCACAGTACCGGCATGATTA | Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:43 | 0 | |
|
pRRG290-IF1 Resource Report Resource Website |
RRID:Addgene_99100 | IF-1 in situ probe | Schmidtea mediterranea | Ampicillin and Kanamycin | PMID:27612384 | Cloning primers: F-AATGAATTGTCCGCTCTTGC, R-TGAATTATTGAATCGGCTTCTG | Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:43 | 0 | |
|
pRRG370-GS1 Resource Report Resource Website |
RRID:Addgene_99101 | GS-1 in situ probe | Schmidtea mediterranea | Ampicillin and Kanamycin | PMID:27612384 | Cloning primers: F-ATCATCCATGGTTTGGCATT, R-CGTCCGGTTAAACGATGTCT | Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:44 | 0 | |
|
pRRG796-jagged-like Resource Report Resource Website |
RRID:Addgene_99103 | jagged-like in situ probe | Schmidtea mediterranea | Ampicillin and Kanamycin | PMID:27612384 | Cloning primers: F-AAAAACCGATAGTCGAAAGC, R-ATCGTCAACTTTTTCGGAAT | Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:43 | 0 | |
|
H11-CAG-loxP-FNF-bpA-3pA-loxP-tdTomato Resource Report Resource Website |
RRID:Addgene_180156 | tdTomato | Synthetic | Ampicillin and Kanamycin | A reporter expression cassette with short homology arms to Hipp11 on either side. Constructed originally for generating Hipp11 reporter allele targeting vector by recombineering. Untested for other purposes, but may be useful for CRISPR knock-in as well. | Backbone Marker:Hyung-song Nam, Capecchi laboratory; Vector Backbone:Custom; Vector Types:Mammalian Expression, Bacterial Expression, Mouse Targeting, Cre/Lox; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:22:50 | 0 | ||
|
pCAT.000 Resource Report Resource Website |
RRID:Addgene_119559 | Ampicillin and Kanamycin | PMID:30819783 | Please visit https://www.biorxiv.org/content/10.1101/426700v1 for bioRxiv preprint. | Vector Backbone:pPMQAK1; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:03:14 | 0 | |||
|
6377 H10-104b Resource Report Resource Website 1+ mentions |
RRID:Addgene_1248 | Hsp104 | Saccharomyces cerevisiae | Ampicillin and Kanamycin | PMID:9674429 | Backbone Size:0; Vector Backbone:pJC45S; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:04:09 | 4 | ||
|
pHybr_r2a>Fab-srt-his Resource Report Resource Website 1+ mentions |
RRID:Addgene_124810 | rat IgG2a Hinge-G4S-Sortag-Histag | Rattus norvegicus | Ampicillin and Kanamycin | PMID:31489367 | Backbone Marker:Thermo Fisher; Backbone Size:3956; Vector Backbone:pCR4 TOPO TA; Vector Types:Bacterial Expression, CRISPR, HDR template; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:04:09 | 1 | ||
|
LSB-hsa-miR-92a-1-5p Resource Report Resource Website |
RRID:Addgene_103750 | hsa-miR-92a-1-5p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:00:36 | 0 | |
|
LSB-hsa-miR-93-5p Resource Report Resource Website |
RRID:Addgene_103756 | hsa-miR-93-5p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:00:36 | 0 | |
|
LSB-hsa-miR-942-5p Resource Report Resource Website |
RRID:Addgene_103759 | hsa-miR-942-5p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:00:36 | 0 | |
|
LSB-hsa-miR-92a-3p Resource Report Resource Website |
RRID:Addgene_103752 | hsa-miR-92a-3p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:00:36 | 0 | |
|
LSB-hsa-miR-93-3p Resource Report Resource Website |
RRID:Addgene_103755 | hsa-miR-93-3p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:00:36 | 0 | |
|
LSB-hsa-miR-96-3p Resource Report Resource Website |
RRID:Addgene_103760 | hsa-miR-96-3p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:00:37 | 0 | |
|
LSB-hsa-miR-98-3p Resource Report Resource Website |
RRID:Addgene_103762 | hsa-miR-98-3p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:00:36 | 0 | |
|
LSB-hsa-miR-99a-3p Resource Report Resource Website |
RRID:Addgene_103764 | hsa-miR-99a-3p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:00:36 | 0 | |
|
LSB-hsa-miR-98-5p Resource Report Resource Website |
RRID:Addgene_103763 | hsa-miR-98-5p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-15 01:00:37 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
