Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 45 showing 881 ~ 900 out of 1,969 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_99095

http://www.addgene.org/99095

Species: Schmidtea mediterranea
Genetic Insert: LDLRR-3 in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27612384
Comments: Cloning primers: F-GATGTTTAGACCATAGTATATG, R-GAATTGAAGATAAAATAAATTG

Proper citation: RRID:Addgene_99095 Copy   


  • RRID:Addgene_99097

http://www.addgene.org/99097

Species: Schmidtea mediterranea
Genetic Insert: Arrowhead in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27612384
Comments: Cloning primers: F-TTGATGGAAAGTGTTTTGGTTG, R-TTTTCAGTTTTCCCGTTACAAA

Proper citation: RRID:Addgene_99097 Copy   


  • RRID:Addgene_176529

http://www.addgene.org/176529

Species: Synthetic
Genetic Insert: FnCpf1
Vector Backbone Description: Backbone Marker:Uffe Mortensen (Addgene plasmid # 87844); Vector Backbone:pFC333; Vector Types:CRISPR, Fungal Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:33573639

Proper citation: RRID:Addgene_176529 Copy   


  • RRID:Addgene_99099

http://www.addgene.org/99099

Species: Schmidtea mediterranea
Genetic Insert: FLI-1 in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27612384
Comments: Cloning primers: F-CGGACTTGGACTATCGGAAA, R-CCACAGTACCGGCATGATTA

Proper citation: RRID:Addgene_99099 Copy   


  • RRID:Addgene_99100

http://www.addgene.org/99100

Species: Schmidtea mediterranea
Genetic Insert: IF-1 in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27612384
Comments: Cloning primers: F-AATGAATTGTCCGCTCTTGC, R-TGAATTATTGAATCGGCTTCTG

Proper citation: RRID:Addgene_99100 Copy   


  • RRID:Addgene_99101

http://www.addgene.org/99101

Species: Schmidtea mediterranea
Genetic Insert: GS-1 in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27612384
Comments: Cloning primers: F-ATCATCCATGGTTTGGCATT, R-CGTCCGGTTAAACGATGTCT

Proper citation: RRID:Addgene_99101 Copy   


  • RRID:Addgene_99103

http://www.addgene.org/99103

Species: Schmidtea mediterranea
Genetic Insert: jagged-like in situ probe
Vector Backbone Description: Backbone Marker:Phillip Newmark (Addgene plasmid # 26536); Backbone Size:3240; Vector Backbone:pJC53.2; Vector Types:T/A Cloning Vector for dsRNA generation and the generation of sense and anti-sense probes; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:27612384
Comments: Cloning primers: F-AAAAACCGATAGTCGAAAGC, R-ATCGTCAACTTTTTCGGAAT

Proper citation: RRID:Addgene_99103 Copy   


http://www.addgene.org/180156

Species: Synthetic
Genetic Insert: tdTomato
Vector Backbone Description: Backbone Marker:Hyung-song Nam, Capecchi laboratory; Vector Backbone:Custom; Vector Types:Mammalian Expression, Bacterial Expression, Mouse Targeting, Cre/Lox; Bacterial Resistance:Ampicillin and Kanamycin
Comments: A reporter expression cassette with short homology arms to Hipp11 on either side. Constructed originally for generating Hipp11 reporter allele targeting vector by recombineering. Untested for other purposes, but may be useful for CRISPR knock-in as well.

Proper citation: RRID:Addgene_180156 Copy   


  • RRID:Addgene_119559

http://www.addgene.org/119559

Vector Backbone Description: Vector Backbone:pPMQAK1; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:30819783
Comments: Please visit https://www.biorxiv.org/content/10.1101/426700v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_119559 Copy   


  • RRID:Addgene_1248

    This resource has 1+ mentions.

http://www.addgene.org/1248

Species: Saccharomyces cerevisiae
Genetic Insert: Hsp104
Vector Backbone Description: Backbone Size:0; Vector Backbone:pJC45S; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:9674429

Proper citation: RRID:Addgene_1248 Copy   


  • RRID:Addgene_124810

    This resource has 1+ mentions.

http://www.addgene.org/124810

Species: Rattus norvegicus
Genetic Insert: rat IgG2a Hinge-G4S-Sortag-Histag
Vector Backbone Description: Backbone Marker:Thermo Fisher; Backbone Size:3956; Vector Backbone:pCR4 TOPO TA; Vector Types:Bacterial Expression, CRISPR, HDR template; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:31489367

Proper citation: RRID:Addgene_124810 Copy   


  • RRID:Addgene_103750

http://www.addgene.org/103750

Species: Homo sapiens
Genetic Insert: hsa-miR-92a-1-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.

Proper citation: RRID:Addgene_103750 Copy   


  • RRID:Addgene_103756

http://www.addgene.org/103756

Species: Homo sapiens
Genetic Insert: hsa-miR-93-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.

Proper citation: RRID:Addgene_103756 Copy   


  • RRID:Addgene_103759

http://www.addgene.org/103759

Species: Homo sapiens
Genetic Insert: hsa-miR-942-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.

Proper citation: RRID:Addgene_103759 Copy   


  • RRID:Addgene_103752

http://www.addgene.org/103752

Species: Homo sapiens
Genetic Insert: hsa-miR-92a-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.

Proper citation: RRID:Addgene_103752 Copy   


  • RRID:Addgene_103755

http://www.addgene.org/103755

Species: Homo sapiens
Genetic Insert: hsa-miR-93-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.

Proper citation: RRID:Addgene_103755 Copy   


  • RRID:Addgene_103760

http://www.addgene.org/103760

Species: Homo sapiens
Genetic Insert: hsa-miR-96-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.

Proper citation: RRID:Addgene_103760 Copy   


  • RRID:Addgene_103762

http://www.addgene.org/103762

Species: Homo sapiens
Genetic Insert: hsa-miR-98-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.

Proper citation: RRID:Addgene_103762 Copy   


  • RRID:Addgene_103764

http://www.addgene.org/103764

Species: Homo sapiens
Genetic Insert: hsa-miR-99a-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.

Proper citation: RRID:Addgene_103764 Copy   


  • RRID:Addgene_103763

http://www.addgene.org/103763

Species: Homo sapiens
Genetic Insert: hsa-miR-98-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Please contact [email protected] if you are interested in this plasmid prior to placing an order.

Proper citation: RRID:Addgene_103763 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X