Plasmids   Select Another Resource Report Type

http://www.addgene.org/198821

Species: Caenorhabditis elegans
Genetic Insert: 15xUAS::rpl-22HA-SL2-mKate::let-858 3'UTR
Vector Backbone Description: Backbone Marker:Fire Lab C. elegans Vector Kit; Vector Backbone:pPD117.01; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38096407

Proper citation: RRID:Addgene_198821 Copy   

•   Source: Addgene

http://www.addgene.org/198786

Species: Caenorhabditis elegans
Genetic Insert: Psrt-28-GAL4-SK(DBD)-VP64
Vector Backbone Description: Backbone Size:3611; Vector Backbone:pHW393; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38096407

Proper citation: RRID:Addgene_198786 Copy   

•   Source: Addgene

http://www.addgene.org/198798

Species: Caenorhabditis elegans
Genetic Insert: Psrg-13-GAL4-SK(DBD)-VP64
Vector Backbone Description: Backbone Size:3611; Vector Backbone:pHW393; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38096407

Proper citation: RRID:Addgene_198798 Copy   

•   Source: Addgene

http://www.addgene.org/200334

Species: Caenorhabditis elegans
Genetic Insert: [ASELp | gfp | tbb-2 UTR]
Vector Backbone Description: Backbone Marker:Twist Biosciences; Vector Backbone:Twist Amp High; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Comments: See www.wormbuilder.org/BioParts for more information.

Proper citation: RRID:Addgene_200334 Copy   

•   Source: Addgene

http://www.addgene.org/200343

Species: Caenorhabditis elegans
Genetic Insert: [OLQp | wrmScarlet | tbb-2 UTR]
Vector Backbone Description: Backbone Marker:Twist Biosciences; Vector Backbone:Twist Amp High; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Comments: See www.wormbuilder.org/BioParts for more information.

Proper citation: RRID:Addgene_200343 Copy   

•   Source: Addgene

http://www.addgene.org/200341

Species: Caenorhabditis elegans
Genetic Insert: [PVPp | wrmScarlet | tbb-2 UTR]
Vector Backbone Description: Backbone Marker:Twist Biosciences; Vector Backbone:Twist Amp High; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Comments: See www.wormbuilder.org/BioParts for more information.

Proper citation: RRID:Addgene_200341 Copy   

•   Source: Addgene

http://www.addgene.org/200342

Species: Caenorhabditis elegans
Genetic Insert: [PVPp | gfp | tbb-2 UTR]
Vector Backbone Description: Backbone Marker:Twist Biosciences; Vector Backbone:Twist Amp High; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Comments: See www.wormbuilder.org/BioParts for more information.

Proper citation: RRID:Addgene_200342 Copy   

•   Source: Addgene

http://www.addgene.org/200328

Species: Caenorhabditis elegans
Genetic Insert: [DDp | gfp | tbb-2 UTR]
Vector Backbone Description: Backbone Marker:Twist Biosciences; Vector Backbone:Twist Amp High; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Comments: See www.wormbuilder.org/BioParts for more information.

Proper citation: RRID:Addgene_200328 Copy   

•   Source: Addgene

http://www.addgene.org/200336

Species: Caenorhabditis elegans
Genetic Insert: [ASELp | gfp | tbb-2 UTR]
Vector Backbone Description: Backbone Marker:Twist Biosciences; Vector Backbone:Twist Amp High; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Comments: See www.wormbuilder.org/BioParts for more information.

Proper citation: RRID:Addgene_200336 Copy   

•   Source: Addgene

http://www.addgene.org/200331

Species: Caenorhabditis elegans
Genetic Insert: [ASERp | wrmScarlet | tbb-2 UTR]
Vector Backbone Description: Backbone Marker:Twist Biosciences; Vector Backbone:Twist Amp High; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Comments: See www.wormbuilder.org/BioParts for more information.

Proper citation: RRID:Addgene_200331 Copy   

•   Source: Addgene

http://www.addgene.org/200346

Species: Caenorhabditis elegans
Genetic Insert: [AWAp | gfp | tbb-2 UTR]
Vector Backbone Description: Backbone Marker:Twist Biosciences; Vector Backbone:Twist Amp High; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Comments: See www.wormbuilder.org/BioParts for more information.

Proper citation: RRID:Addgene_200346 Copy   

•   Source: Addgene

http://www.addgene.org/200349

Species: Caenorhabditis elegans
Genetic Insert: [ADFp | wrmScarlet | tbb-2 UTR]
Vector Backbone Description: Backbone Marker:Twist Biosciences; Vector Backbone:Twist Amp High; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Comments: See www.wormbuilder.org/BioParts for more information.

Proper citation: RRID:Addgene_200349 Copy   

•   Source: Addgene

http://www.addgene.org/200350

Species: Caenorhabditis elegans
Genetic Insert: [ADFp | gfp | tbb-2 UTR]
Vector Backbone Description: Backbone Marker:Twist Biosciences; Vector Backbone:Twist Amp High; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Comments: See www.wormbuilder.org/BioParts for more information.

Proper citation: RRID:Addgene_200350 Copy   

•   Source: Addgene

http://www.addgene.org/200351

Species: Caenorhabditis elegans
Genetic Insert: [AWBp | wrmScarlet | tbb-2 UTR]
Vector Backbone Description: Backbone Marker:Twist Biosciences; Vector Backbone:Twist Amp High; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Comments: See www.wormbuilder.org/BioParts for more information.

Proper citation: RRID:Addgene_200351 Copy   

•   Source: Addgene

http://www.addgene.org/215676

Species: Caenorhabditis elegans
Genetic Insert: eef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
Vector Backbone Description: Vector Backbone:pDD162; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38351905

Proper citation: RRID:Addgene_215676 Copy   

•   Source: Addgene

http://www.addgene.org/215675

Species: Caenorhabditis elegans
Genetic Insert: eef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
Vector Backbone Description: Vector Backbone:pDD162; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38351905

Proper citation: RRID:Addgene_215675 Copy   

•   Source: Addgene

http://www.addgene.org/109326

Species: Caenorhabditis elegans
Genetic Insert: mex-5
Vector Backbone Description: Backbone Marker:Askjaer lab; Vector Backbone:pBN338; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32550382

Proper citation: RRID:Addgene_109326 Copy   

•   Source: Addgene

http://www.addgene.org/11030

Species: Caenorhabditis elegans
Genetic Insert: End-1
Vector Backbone Description: Backbone Size:4095; Vector Backbone:pCS2; Vector Types:xenopus, mammalian, avian, and zebrafish; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10760276

Proper citation: RRID:Addgene_11030 Copy   

•   Source: Addgene

http://www.addgene.org/110930

Species: Caenorhabditis elegans
Genetic Insert: rab-3 promoter
Vector Backbone Description: Backbone Size:2632; Vector Backbone:pUC; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15489510
Comments: Unique multi-cloning sites: Nhe I, Sbf I, Kpn I/ Age I/ Xho I, Bgl II This vector is the same as KG#59, except the Sal I and Acc I sites of the multi-cloning site have been replaced with a Sbf I site. Synthesized 2 complementary oligos containing Nhe I and Age I sticky ends and Sbf I and Kpn I sites in between. Hybridization of the 2 oligos to each other will produce Nhe I and Age I sticky ends. After hybridization, this synthetic insert (which is non-phosphorylated on its 5' termini) was cloned into Nhe I/ Age I cut KG#59. Transformed into XL1-Blue electrocompetent cells. Miniprepped 6 clones and tested for the Sbf I site by cutting with Sbf I. Chose one clone that has the Sbf I site with correct band size (and only a single band) and made the glycerol stock. Features of the expression construct: This expression construct has a promoter (rab-3) that will drive strong and specific expression (of whatever gene is inserted in the MCS) in the entire nervous system of juvenile and adult animals. The boundaries of the rab-3 promoter sequence were obtained by examining pRabGFPrim3' from Mike Nonet's lab web site and comparing that to the genome sequence. Other features of the expression vector include a "decoy" 5' to the promoter to reduce non-specific expression in the gut (see Fire Lab 1995 Kit documentation for description), the unc-54 3' end including the poly A addition signal, and 3 introns (1 in 5' UTR, 1 just upstream of the unc-54 3' end, and 1 inserted in the unc-54 3' end). These introns help provide more uniform and robust expression, especially if you are expressing a cDNA with no introns as opposed to a gene with introns. Note: this vector can be converted to a vector that fuses GFP, YFP, or CFP onto the C-terminus of the protein as follows: Remove the ~1000 bp (Kpn I or Age I) + (Spe I or BsiW I [expensive, 55 C cutter with 50% activity at 37 C; heat inactivate 80 C] or Apa I) fragment containing the unc-54 3’ control region from this plasmid and replace it with the ~1800 bp like-digested fragment containing 3-intron S65C GFP (see pPD94.81 in Fire Lab plasmids), YFP (see pPD136.64 in Fire Lab plasmids) or CFP (see pPD136.61 in Fire Lab plasmids) + the unc-54 3’ UTR and control region. Note if Spe I is used to cut these Fire Lab vectors, you get 3 bands: 1100, 1800, and 4000 (total size 6.9 Kb). The 1800 bp band is the XFP-containing band. For C-terminal fusions, remember to leave the stop codon off of the upstream protein. For the above-mentioned Fire Lab vectors, the reading frame for the downstream XFP relative to the Kpn I and Age I sites is as follows (triplets are the reading frame codons): Kpn I G GTA CCG GT Age I Alternatively, use Gibson Assembly/ NEBuilder to insert any genetically encoded fluorescent protein at the N- or C-terminus of your protein.

Proper citation: RRID:Addgene_110930 Copy   

•   Source: Addgene

http://www.addgene.org/110931

Species: Caenorhabditis elegans
Genetic Insert: unc-17 promoter
Vector Backbone Description: Backbone Size:2632; Vector Backbone:pUC; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17942708
Comments: Unique multi-cloning sites: Nhe I, Sal I, Kpn I/ Age I/ Eco RV, Bgl II Used Apa I/ Msc I to cut out the ~1900 bp GFP/ 3' control region from RM#349p, leaving the 5900 bp vector fragment containing the unc-17 full promoter + remaining vector sequences. To this vector fragment, we ligated the 1079 bp Apa I/ Msc I fragment cut from pPD96.52 (C. elegans body wall muscle expression vector). Picked 6 colonies for minipreps. Chose 1 clone with correct size insert and made glycerol stock. Features of the expression construct: This is a C. elegans expression vector with the unc-17 3.2 Kb promoter + a large MCS for cloning in cDNAs. Includes cha-1/unc-17 upstream region from Sna-1 (=Bst1107 I = GTA/TAC) down to first half of the 66 bp first exon (which is common to unc-17 and cha-1 transcripts but is not translated). Includes beta site so that expression occurs in most cholinergic cells. Expression still missing from VC's and some cholinergic head and tail neurons. In this construct the GFP/ 3' control region of RM#349p is replaced with the MCS II + 3' control region of pPD96.52. This includes the unc-54 3' end including the poly A addition signal, and 3 introns (1 in 5' UTR, 1 just upstream of the unc-54 3' end, and 1 inserted in the unc-54 3' end). These introns help provide more uniform and robust expression, especially if you are expressing a cDNA with no introns as opposed to a gene with introns. Note: this vector can be converted to a vector that fuses GFP, YFP, or CFP onto the C-terminus of the protein as follows: Remove the ~1000 bp (Kpn I or Age I) + (Spe I or BsiW I [expensive, 55 C cutter with 50% activity at 37 C; heat inactivate 80 C] or Apa I) fragment containing the unc-54 3’ control region from this plasmid and replace it with the ~1800 bp like-digested fragment containing 3-intron S65C GFP (see pPD94.81 in Fire Lab plasmids), YFP (see pPD136.64 in Fire Lab plasmids) or CFP (see pPD136.61 in Fire Lab plasmids) + the unc-54 3’ UTR and control region. Note if Spe I is used to cut these Fire Lab vectors, you get 3 bands: 1100, 1800, and 4000 (total size 6.9 Kb). The 1800 bp band is the XFP-containing band. For C-terminal fusions, remember to leave the stop codon off of the upstream protein. For the above-mentioned Fire Lab vectors, the reading frame for the downstream XFP relative to the Kpn I and Age I sites is as follows (triplets are the reading frame codons): Kpn I G GTA CCG GT Age I Alternatively, use Gibson Assembly/ NEBuilder to insert any genetically encoded fluorescent protein at the N- or C-terminus of your protein.

Proper citation: RRID:Addgene_110931 Copy   

•   Source: Addgene