Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:synthetic (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

30,421 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pDONR P4-P1R-V5-6xHis
 
Resource Report
Resource Website 		RRID:Addgene_48346 V5 and 6xHis epitope tags cassette Synthetic Kanamycin PMID:23957834 Backbone Marker:Life Technologies/Invitrogen; Backbone Size:2645; Vector Backbone:pDONRP4-P1R; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin Contains a Kozak sequence and initiation codon upstream of V5 tag. Does not contain a stop codon. 2026-08-15 01:15:49 0
pDONR P4-P1R-mKate2
 
Resource Report
Resource Website 		RRID:Addgene_48344 mKate2 Synthetic Kanamycin PMID:23957834 Backbone Marker:Life Technologies/Invitrogen; Backbone Size:2646; Vector Backbone:pDONRP4-P1R; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin It contains a Kozak sequence but no stop codon. 2026-08-15 01:15:49 0
pC1-HyPer-Red-C199S
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_48252 HYPER-RED-C199S Synthetic Kanamycin PMID:25330925 Backbone Size:3975; Vector Backbone:pC1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:15:48 3
pAC154-dual-dCas9VP160-sgExpression
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_48240 dCas9 Synthetic Ampicillin PMID:23979020 Clone sgRNA spacer into BbsI site. Sequence using LKO5' primer: GACTATCATATGCTTACCGT For more information including protocols and updates, please go to http://www.crispr-on.org Vector Backbone:pX335 (Addgene #42335); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin D10A H840A 2026-08-15 01:15:48 24
pDONR P2R-P3-ECFP
 
Resource Report
Resource Website 		RRID:Addgene_48353 ECFP Synthetic Kanamycin PMID:23957834 Backbone Marker:Life Technologies/Invitrogen; Backbone Size:2651; Vector Backbone:pDONRP2R-P3; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin Contains a stop codon. 2026-08-15 01:15:49 0
pFUSB4_CATG
 
Resource Report
Resource Website 		RRID:Addgene_48446 RVD sequence: HD NI NG NN Synthetic Spectinomycin PMID:23734242 Plasmid was created using Golden Gate cloning. Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin 2026-08-15 01:15:50 0
pFUSB4_CATA
 
Resource Report
Resource Website 		RRID:Addgene_48444 RVD sequence: HD NI NG NI Synthetic Spectinomycin PMID:23734242 Plasmid was created using Golden Gate cloning. Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin 2026-08-15 01:15:50 0
pFUSB4_CCAC
 
Resource Report
Resource Website 		RRID:Addgene_48449 RVD sequence: HD HD NI HD Synthetic Spectinomycin PMID:23734242 Plasmid was created using Golden Gate cloning. Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin 2026-08-15 01:15:50 0
pFUSB4_CCAA
 
Resource Report
Resource Website 		RRID:Addgene_48448 RVD sequence: HD HD NI NI Synthetic Spectinomycin PMID:23734242 Plasmid was created using Golden Gate cloning. Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin 2026-08-15 01:15:50 0
pFUSB4_CAGT
 
Resource Report
Resource Website 		RRID:Addgene_48443 RVD sequence: HD NI NN NG Synthetic Spectinomycin PMID:23734242 Plasmid was created using Golden Gate cloning. Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin 2026-08-15 01:15:50 0
pFUSB4_CAGG
 
Resource Report
Resource Website 		RRID:Addgene_48442 RVD sequence: HD NI NN NN Synthetic Spectinomycin PMID:23734242 Plasmid was created using Golden Gate cloning. Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin 2026-08-15 01:15:50 0
pFUSB4_CAGA
 
Resource Report
Resource Website 		RRID:Addgene_48440 RVD sequence: HD NI NN NI Synthetic Spectinomycin PMID:23734242 Plasmid was created using Golden Gate cloning. Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin 2026-08-15 01:15:50 0
pFUSB4_CACA
 
Resource Report
Resource Website 		RRID:Addgene_48436 RVD sequence: HD NI HD NI Synthetic Spectinomycin PMID:23734242 Plasmid was created using Golden Gate cloning. Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin 2026-08-15 01:15:50 0
pFUSB4_CAAT
 
Resource Report
Resource Website 		RRID:Addgene_48435 RVD sequence: HD NI NI NG Synthetic Spectinomycin PMID:23734242 Plasmid was created using Golden Gate cloning. Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin 2026-08-15 01:15:50 0
pFUSB4_CAAG
 
Resource Report
Resource Website 		RRID:Addgene_48434 RVD sequence: HD NI NI NN Synthetic Spectinomycin PMID:23734242 Plasmid was created using Golden Gate cloning. Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin 2026-08-15 01:15:50 0
pFUSB4_CAAC
 
Resource Report
Resource Website 		RRID:Addgene_48433 RVD sequence: HD NI NI HD Synthetic Spectinomycin PMID:23734242 Plasmid was created using Golden Gate cloning. Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin 2026-08-15 01:15:50 0
pFUSB4_ACGT
 
Resource Report
Resource Website 		RRID:Addgene_48395 RVD sequence: NI HD NN NG Synthetic Spectinomycin PMID:23734242 Plasmid was created using Golden Gate cloning. Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin 2026-08-15 01:15:50 0
pFUSB4_ACGA
 
Resource Report
Resource Website 		RRID:Addgene_48392 RVD sequence: NI HD NN NI Synthetic Spectinomycin PMID:23734242 Plasmid was created using Golden Gate cloning. Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin 2026-08-15 01:15:50 0
pFUSB4_ACTT
 
Resource Report
Resource Website 		RRID:Addgene_48399 RVD sequence: NI HD NG NG Synthetic Spectinomycin PMID:23734242 Plasmid was created using Golden Gate cloning. Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin 2026-08-15 01:15:50 0
pFUSB4_ATTT
 
Resource Report
Resource Website 		RRID:Addgene_48431 RVD sequence: NI NG NG NG Synthetic Spectinomycin PMID:23734242 Plasmid was created using Golden Gate cloning. Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin 2026-08-15 01:15:50 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch