Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: Cyth4
Vector Backbone Description: Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_117456 Copy
Species: Homo sapiens
Genetic Insert: ALK2
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9748228
Proper citation: RRID:Addgene_11740 Copy
Species: Homo sapiens
Genetic Insert: SMURF2
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11163210
Proper citation: RRID:Addgene_11746 Copy
Species: Homo sapiens
Genetic Insert: Iqsec1
Vector Backbone Description: Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_117444 Copy
Species: Mus musculus
Genetic Insert: ELMOD3
Vector Backbone Description: Vector Backbone:eneArt vector; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_117443 Copy
Species: Homo sapiens
Genetic Insert: Iqsec1
Vector Backbone Description: Vector Backbone:pcDNA-DEST42; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_117446 Copy
Species: Homo sapiens
Genetic Insert: ARL3
Vector Backbone Description: Vector Backbone:pET3c; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8034651
Proper citation: RRID:Addgene_117433 Copy
Species: Homo sapiens
Genetic Insert: ARL6
Vector Backbone Description: Vector Backbone:pET3c; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_117435 Copy
Species: Synthetic
Genetic Insert: mPlum
Vector Backbone Description: Vector Backbone:pUC18; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30301859
Proper citation: RRID:Addgene_117396 Copy
Species: Synthetic
Genetic Insert: dTomato
Vector Backbone Description: Vector Backbone:pUC18; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30301859
Proper citation: RRID:Addgene_117395 Copy
Vector Backbone Description: Vector Backbone:pUC18R6K; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30301859
Proper citation: RRID:Addgene_117398 Copy
Vector Backbone Description: Vector Backbone:pUC18R6K; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30301859
Proper citation: RRID:Addgene_117397 Copy
Species: Homo sapiens
Genetic Insert: ARL2
Vector Backbone Description: Vector Backbone:pET3c; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8415637
Proper citation: RRID:Addgene_117430 Copy
Species: Synthetic
Genetic Insert: mPlum
Vector Backbone Description: Vector Backbone:pGEN-mcs (ori15A); Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30301859
Proper citation: RRID:Addgene_117388 Copy
Species: Homo sapiens
Genetic Insert: ARF1
Vector Backbone Description: Vector Backbone:pET3c; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1899243
Proper citation: RRID:Addgene_117424 Copy
Species: Synthetic
Genetic Insert: GCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
Vector Backbone Description: Backbone Size:5352; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30626963
Proper citation: RRID:Addgene_117384 Copy
Species: Other
Genetic Insert: channel rhodopsin-2 with H134R mutation
Vector Backbone Description: Vector Backbone:pPD95.75; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29939997
Proper citation: RRID:Addgene_117420 Copy
Species: Homo sapiens
Genetic Insert: ARF4
Vector Backbone Description: Vector Backbone:pET3c; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1899243
Proper citation: RRID:Addgene_117426 Copy
Species: Homo sapiens
Genetic Insert: ARF3
Vector Backbone Description: Vector Backbone:pET3c; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2474826
Proper citation: RRID:Addgene_117425 Copy
Species: Synthetic
Genetic Insert: mPlum
Vector Backbone Description: Vector Backbone:pUC18R6K; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30301859
Proper citation: RRID:Addgene_117392 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.