Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 450 showing 8981 ~ 9000 out of 740,584 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_59992

http://www.addgene.org/59992

Species: Saccharomyces cerevisiae
Genetic Insert: promoter
Vector Backbone Description: Backbone Size:6000; Vector Backbone:p416; Vector Types:Yeast Expression, Synthetic Biology, Yeast synthetic hybrid promoter construct; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22565375

Proper citation: RRID:Addgene_59992 Copy   


  • RRID:Addgene_60071

http://www.addgene.org/60071

Genetic Insert: pair of multiplex gRNAs targeting EGFP
Vector Backbone Description: Backbone Marker:Joung lab (Addgene plasmid # 53370); Vector Backbone:pSQT1313; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24770325
Comments: Left gRNA target site: AAGTTCAGCGTGTCCGGCGA Right gRNA target site: CCGTCCAGCTCGACCAGGAT

Proper citation: RRID:Addgene_60071 Copy   


  • RRID:Addgene_60077

http://www.addgene.org/60077

Species: Homo sapiens
Genetic Insert: Cylindromatosis
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:2600; Vector Backbone:pENTR; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17495026

Proper citation: RRID:Addgene_60077 Copy   


  • RRID:Addgene_60126

http://www.addgene.org/60126

Vector Backbone Description: Backbone Size:6600; Vector Backbone:pLNCX; Vector Types:Retroviral; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_60126 Copy   


  • RRID:Addgene_60128

    This resource has 1+ mentions.

http://www.addgene.org/60128

Species: Homo sapiens
Genetic Insert: protein kinase B
Vector Backbone Description: Backbone Size:6600; Vector Backbone:pLNCX; Vector Types:Retroviral; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_60128 Copy   


  • RRID:Addgene_60121

http://www.addgene.org/60121

Species: Homo sapiens
Genetic Insert: WDR5WDR5:APC041-G05:C36415
Vector Backbone Description: Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: For more information, please see: PDB / SGC http://www.thesgc.org/structures/3UR4/ https://www.rcsb.org/structure/unreleased/9D5Z/

Proper citation: RRID:Addgene_60121 Copy   


  • RRID:Addgene_60136

http://www.addgene.org/60136

Species: Photinus pyralis
Genetic Insert: FLuc
Vector Backbone Description: Backbone Size:5261; Vector Backbone:p406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25232010

Proper citation: RRID:Addgene_60136 Copy   


  • RRID:Addgene_60139

http://www.addgene.org/60139

Species: Synthetic
Genetic Insert: CBG99
Vector Backbone Description: Backbone Size:5261; Vector Backbone:p406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25232010

Proper citation: RRID:Addgene_60139 Copy   


  • RRID:Addgene_60138

http://www.addgene.org/60138

Species: Synthetic
Genetic Insert: CBR
Vector Backbone Description: Backbone Size:5261; Vector Backbone:p406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25232010

Proper citation: RRID:Addgene_60138 Copy   


  • RRID:Addgene_60099

http://www.addgene.org/60099

Species: Synthetic
Genetic Insert: SNAP-tag
Vector Backbone Description: Backbone Marker:custom; Backbone Size:4600; Vector Backbone:pAAV-CMV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25157152

Proper citation: RRID:Addgene_60099 Copy   


  • RRID:Addgene_60146

http://www.addgene.org/60146

Species: Synthetic
Genetic Insert: RdLuc
Vector Backbone Description: Backbone Size:5480; Vector Backbone:pIS385; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25232010

Proper citation: RRID:Addgene_60146 Copy   


  • RRID:Addgene_60145

http://www.addgene.org/60145

Species: Synthetic
Genetic Insert: YeLuc
Vector Backbone Description: Backbone Size:5480; Vector Backbone:pIS385; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25232010

Proper citation: RRID:Addgene_60145 Copy   


  • RRID:Addgene_60143

http://www.addgene.org/60143

Species: Photinus pyralis
Genetic Insert: FLuc-yEVenus-PEST
Vector Backbone Description: Backbone Size:5261; Vector Backbone:p406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25232010

Proper citation: RRID:Addgene_60143 Copy   


  • RRID:Addgene_60159

http://www.addgene.org/60159

Species: Photinus pyralis
Genetic Insert: FLuc
Vector Backbone Description: Backbone Size:6357; Vector Backbone:p406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25232010

Proper citation: RRID:Addgene_60159 Copy   


  • RRID:Addgene_60154

    This resource has 1+ mentions.

http://www.addgene.org/60154

Species: Synthetic
Genetic Insert: CBG99
Vector Backbone Description: Backbone Size:6260; Vector Backbone:p406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25232010

Proper citation: RRID:Addgene_60154 Copy   


  • RRID:Addgene_60202

    This resource has 1+ mentions.

http://www.addgene.org/60202

Species: Mus musculus
Genetic Insert: NAIP6
Vector Backbone Description: Vector Backbone:mscv2.2; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21874021

Proper citation: RRID:Addgene_60202 Copy   


  • RRID:Addgene_60206

    This resource has 1+ mentions.

http://www.addgene.org/60206

Vector Backbone Description: Vector Backbone:mscv2.2; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21874021

Proper citation: RRID:Addgene_60206 Copy   


  • RRID:Addgene_60208

http://www.addgene.org/60208

Species: Homo sapiens
Genetic Insert: Cre recombinase
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14576331

Proper citation: RRID:Addgene_60208 Copy   


  • RRID:Addgene_60162

http://www.addgene.org/60162

Species: Photinus pyralis
Genetic Insert: FLuc
Vector Backbone Description: Backbone Size:5280; Vector Backbone:p406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25232010

Proper citation: RRID:Addgene_60162 Copy   


  • RRID:Addgene_60166

http://www.addgene.org/60166

Species: Photinus pyralis
Genetic Insert: FLuc-yEVenus-PEST
Vector Backbone Description: Backbone Size:5820; Vector Backbone:p406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25232010

Proper citation: RRID:Addgene_60166 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X