Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Saccharomyces cerevisiae
Genetic Insert: promoter
Vector Backbone Description: Backbone Size:6000; Vector Backbone:p416; Vector Types:Yeast Expression, Synthetic Biology, Yeast synthetic hybrid promoter construct; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22565375
Proper citation: RRID:Addgene_59992 Copy
Genetic Insert: pair of multiplex gRNAs targeting EGFP
Vector Backbone Description: Backbone Marker:Joung lab (Addgene plasmid # 53370); Vector Backbone:pSQT1313; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24770325
Comments: Left gRNA target site: AAGTTCAGCGTGTCCGGCGA
Right gRNA target site: CCGTCCAGCTCGACCAGGAT
Proper citation: RRID:Addgene_60071 Copy
Species: Homo sapiens
Genetic Insert: Cylindromatosis
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:2600; Vector Backbone:pENTR; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17495026
Proper citation: RRID:Addgene_60077 Copy
Vector Backbone Description: Backbone Size:6600; Vector Backbone:pLNCX; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_60126 Copy
Species: Homo sapiens
Genetic Insert: protein kinase B
Vector Backbone Description: Backbone Size:6600; Vector Backbone:pLNCX; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_60128 Copy
Species: Homo sapiens
Genetic Insert: WDR5WDR5:APC041-G05:C36415
Vector Backbone Description: Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: For more information, please see:
PDB / SGC
http://www.thesgc.org/structures/3UR4/
https://www.rcsb.org/structure/unreleased/9D5Z/
Proper citation: RRID:Addgene_60121 Copy
Species: Photinus pyralis
Genetic Insert: FLuc
Vector Backbone Description: Backbone Size:5261; Vector Backbone:p406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25232010
Proper citation: RRID:Addgene_60136 Copy
Species: Synthetic
Genetic Insert: CBG99
Vector Backbone Description: Backbone Size:5261; Vector Backbone:p406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25232010
Proper citation: RRID:Addgene_60139 Copy
Species: Synthetic
Genetic Insert: CBR
Vector Backbone Description: Backbone Size:5261; Vector Backbone:p406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25232010
Proper citation: RRID:Addgene_60138 Copy
Species: Synthetic
Genetic Insert: SNAP-tag
Vector Backbone Description: Backbone Marker:custom; Backbone Size:4600; Vector Backbone:pAAV-CMV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25157152
Proper citation: RRID:Addgene_60099 Copy
Species: Synthetic
Genetic Insert: RdLuc
Vector Backbone Description: Backbone Size:5480; Vector Backbone:pIS385; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25232010
Proper citation: RRID:Addgene_60146 Copy
Species: Synthetic
Genetic Insert: YeLuc
Vector Backbone Description: Backbone Size:5480; Vector Backbone:pIS385; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25232010
Proper citation: RRID:Addgene_60145 Copy
Species: Photinus pyralis
Genetic Insert: FLuc-yEVenus-PEST
Vector Backbone Description: Backbone Size:5261; Vector Backbone:p406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25232010
Proper citation: RRID:Addgene_60143 Copy
Species: Photinus pyralis
Genetic Insert: FLuc
Vector Backbone Description: Backbone Size:6357; Vector Backbone:p406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25232010
Proper citation: RRID:Addgene_60159 Copy
Species: Synthetic
Genetic Insert: CBG99
Vector Backbone Description: Backbone Size:6260; Vector Backbone:p406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25232010
Proper citation: RRID:Addgene_60154 Copy
Species: Mus musculus
Genetic Insert: NAIP6
Vector Backbone Description: Vector Backbone:mscv2.2; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21874021
Proper citation: RRID:Addgene_60202 Copy
Vector Backbone Description: Vector Backbone:mscv2.2; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21874021
Proper citation: RRID:Addgene_60206 Copy
Species: Homo sapiens
Genetic Insert: Cre recombinase
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14576331
Proper citation: RRID:Addgene_60208 Copy
Species: Photinus pyralis
Genetic Insert: FLuc
Vector Backbone Description: Backbone Size:5280; Vector Backbone:p406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25232010
Proper citation: RRID:Addgene_60162 Copy
Species: Photinus pyralis
Genetic Insert: FLuc-yEVenus-PEST
Vector Backbone Description: Backbone Size:5820; Vector Backbone:p406; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25232010
Proper citation: RRID:Addgene_60166 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.