Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
g7s pDONR Resource Report Resource Website |
RRID:Addgene_117456 | Cyth4 | Homo sapiens | Kanamycin | Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:02:54 | 0 | |||
|
pCMV5-ALK2 Q207D Resource Report Resource Website 1+ mentions |
RRID:Addgene_11740 | ALK2 | Homo sapiens | Ampicillin | PMID:9748228 | Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Q207D: activated receptor | 2026-08-15 01:02:53 | 2 | |
|
pCMV5B-Flag-Smurf2 wt Resource Report Resource Website 1+ mentions |
RRID:Addgene_11746 | SMURF2 | Homo sapiens | Ampicillin | PMID:11163210 | Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:02:54 | 9 | ||
|
g13s pDONR Resource Report Resource Website |
RRID:Addgene_117444 | Iqsec1 | Homo sapiens | Kanamycin | Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:02:54 | 0 | |||
|
RT68 Resource Report Resource Website |
RRID:Addgene_117443 | ELMOD3 | Mus musculus | Ampicillin | Vector Backbone:eneArt vector; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:02:53 | 0 | |||
|
g13s pD42 Resource Report Resource Website |
RRID:Addgene_117446 | Iqsec1 | Homo sapiens | Ampicillin | Vector Backbone:pcDNA-DEST42; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:02:53 | 0 | |||
|
CS51 Resource Report Resource Website |
RRID:Addgene_117433 | ARL3 | Homo sapiens | Ampicillin | PMID:8034651 | Vector Backbone:pET3c; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:02:53 | 0 | ||
|
rk12s Resource Report Resource Website |
RRID:Addgene_117435 | ARL6 | Homo sapiens | Ampicillin | Vector Backbone:pET3c; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:02:53 | 0 | |||
|
pTn7xKS-mPlum Resource Report Resource Website |
RRID:Addgene_117396 | mPlum | Synthetic | Ampicillin | PMID:30301859 | Vector Backbone:pUC18; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:02:53 | 0 | ||
|
pTn7xKS-dTomato Resource Report Resource Website |
RRID:Addgene_117395 | dTomato | Synthetic | Ampicillin | PMID:30301859 | Vector Backbone:pUC18; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:02:53 | 0 | ||
|
pAX2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_117398 | Ampicillin | PMID:30301859 | Vector Backbone:pUC18R6K; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:02:53 | 3 | ||||
|
pAX1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_117397 | Ampicillin | PMID:30301859 | Vector Backbone:pUC18R6K; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:02:53 | 1 | ||||
|
pJL15 Resource Report Resource Website |
RRID:Addgene_117430 | ARL2 | Homo sapiens | Ampicillin | PMID:8415637 | Vector Backbone:pET3c; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:02:53 | 0 | ||
|
pXS-mPlum Resource Report Resource Website |
RRID:Addgene_117388 | mPlum | Synthetic | Ampicillin | PMID:30301859 | Vector Backbone:pGEN-mcs (ori15A); Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:02:53 | 0 | ||
|
rk1s Resource Report Resource Website |
RRID:Addgene_117424 | ARF1 | Homo sapiens | Ampicillin | PMID:1899243 | Vector Backbone:pET3c; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:02:53 | 0 | ||
|
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS Resource Report Resource Website |
RRID:Addgene_117384 | GCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA | Synthetic | Ampicillin | PMID:30626963 | Backbone Size:5352; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:02:53 | 0 | ||
|
pPD_Pinx-1::ChR2(H134R)::mCherry Resource Report Resource Website |
RRID:Addgene_117420 | channel rhodopsin-2 with H134R mutation | Other | Ampicillin | PMID:29939997 | Vector Backbone:pPD95.75; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | H134R | 2026-08-15 01:02:53 | 0 | |
|
rk3s Resource Report Resource Website |
RRID:Addgene_117426 | ARF4 | Homo sapiens | Ampicillin | PMID:1899243 | Vector Backbone:pET3c; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:02:53 | 0 | ||
|
pJL16 Resource Report Resource Website |
RRID:Addgene_117425 | ARF3 | Homo sapiens | Ampicillin | PMID:2474826 | Vector Backbone:pET3c; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:02:53 | 0 | ||
|
pTn7xTS-mPlum Resource Report Resource Website |
RRID:Addgene_117392 | mPlum | Synthetic | Ampicillin | PMID:30301859 | Vector Backbone:pUC18R6K; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:02:53 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.