Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

740,584 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
g7s pDONR
 
Resource Report
Resource Website
RRID:Addgene_117456 Cyth4 Homo sapiens Kanamycin Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:02:54 0
pCMV5-ALK2 Q207D
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_11740 ALK2 Homo sapiens Ampicillin PMID:9748228 Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Q207D: activated receptor 2026-08-15 01:02:53 2
pCMV5B-Flag-Smurf2 wt
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_11746 SMURF2 Homo sapiens Ampicillin PMID:11163210 Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:02:54 9
g13s pDONR
 
Resource Report
Resource Website
RRID:Addgene_117444 Iqsec1 Homo sapiens Kanamycin Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:02:54 0
RT68
 
Resource Report
Resource Website
RRID:Addgene_117443 ELMOD3 Mus musculus Ampicillin Vector Backbone:eneArt vector; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:02:53 0
g13s pD42
 
Resource Report
Resource Website
RRID:Addgene_117446 Iqsec1 Homo sapiens Ampicillin Vector Backbone:pcDNA-DEST42; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:02:53 0
CS51
 
Resource Report
Resource Website
RRID:Addgene_117433 ARL3 Homo sapiens Ampicillin PMID:8034651 Vector Backbone:pET3c; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:02:53 0
rk12s
 
Resource Report
Resource Website
RRID:Addgene_117435 ARL6 Homo sapiens Ampicillin Vector Backbone:pET3c; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:02:53 0
pTn7xKS-mPlum
 
Resource Report
Resource Website
RRID:Addgene_117396 mPlum Synthetic Ampicillin PMID:30301859 Vector Backbone:pUC18; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:02:53 0
pTn7xKS-dTomato
 
Resource Report
Resource Website
RRID:Addgene_117395 dTomato Synthetic Ampicillin PMID:30301859 Vector Backbone:pUC18; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:02:53 0
pAX2
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_117398 Ampicillin PMID:30301859 Vector Backbone:pUC18R6K; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:02:53 3
pAX1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_117397 Ampicillin PMID:30301859 Vector Backbone:pUC18R6K; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:02:53 1
pJL15
 
Resource Report
Resource Website
RRID:Addgene_117430 ARL2 Homo sapiens Ampicillin PMID:8415637 Vector Backbone:pET3c; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:02:53 0
pXS-mPlum
 
Resource Report
Resource Website
RRID:Addgene_117388 mPlum Synthetic Ampicillin PMID:30301859 Vector Backbone:pGEN-mcs (ori15A); Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:02:53 0
rk1s
 
Resource Report
Resource Website
RRID:Addgene_117424 ARF1 Homo sapiens Ampicillin PMID:1899243 Vector Backbone:pET3c; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:02:53 0
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
 
Resource Report
Resource Website
RRID:Addgene_117384 GCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA Synthetic Ampicillin PMID:30626963 Backbone Size:5352; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:02:53 0
pPD_Pinx-1::ChR2(H134R)::mCherry
 
Resource Report
Resource Website
RRID:Addgene_117420 channel rhodopsin-2 with H134R mutation Other Ampicillin PMID:29939997 Vector Backbone:pPD95.75; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin H134R 2026-08-15 01:02:53 0
rk3s
 
Resource Report
Resource Website
RRID:Addgene_117426 ARF4 Homo sapiens Ampicillin PMID:1899243 Vector Backbone:pET3c; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:02:53 0
pJL16
 
Resource Report
Resource Website
RRID:Addgene_117425 ARF3 Homo sapiens Ampicillin PMID:2474826 Vector Backbone:pET3c; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:02:53 0
pTn7xTS-mPlum
 
Resource Report
Resource Website
RRID:Addgene_117392 mPlum Synthetic Ampicillin PMID:30301859 Vector Backbone:pUC18R6K; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:02:53 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.