Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Microexon E35a
Vector Backbone Description: Vector Backbone:pCAGGS; Vector Types:Mammalian Expression, Other, TOPO TA vector; Bacterial Resistance:Ampicillin
Comments: Microexon E35a sequence: gagacagagtcagatcaagatgatgag
Proper citation: RRID:Addgene_238352 Copy
Species: Mus musculus
Genetic Insert: Plxnb2
Vector Backbone Description: Backbone Marker:D Eletto; Backbone Size:7453; Vector Backbone:AAV-U6-sgRNA-EF1a-LibVec; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39048831
Proper citation: RRID:Addgene_239600 Copy
Species: Mus musculus
Genetic Insert: Plxnb2
Vector Backbone Description: Backbone Marker:D Eletto; Backbone Size:7453; Vector Backbone:AAV-U6-sgRNA-EF1a-LibVec; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39048831
Proper citation: RRID:Addgene_239599 Copy
Species: Mus musculus
Genetic Insert: Plxnb2
Vector Backbone Description: Backbone Marker:D Eletto; Backbone Size:7453; Vector Backbone:AAV-U6-sgRNA-EF1a-LibVec; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39048831
Proper citation: RRID:Addgene_239597 Copy
Species: Mus musculus
Genetic Insert: Plxnb2
Vector Backbone Description: Backbone Marker:D Eletto; Backbone Size:7453; Vector Backbone:AAV-U6-sgRNA-EF1a-LibVec; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39048831
Proper citation: RRID:Addgene_239596 Copy
Species: Mus musculus
Genetic Insert: Scn8a
Vector Backbone Description: Vector Backbone:pcDNA3.1(+)-P2A-eGFP (P2A-eGFP was replaced by the HA tag); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37288813
Comments: The gene encoding Nav1.6 was synthesized by GenScript.
Proper citation: RRID:Addgene_239773 Copy
Species: Mus musculus
Genetic Insert: Scn8a
Vector Backbone Description: Vector Backbone:pcDNA3.1(+)-P2A-eGFP (P2A-eGFP was replaced by the HA tag); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37288813
Comments: A portion of this plasmid was derived from a plasmid made by GenScript.
Proper citation: RRID:Addgene_239772 Copy
Species: Mus musculus
Genetic Insert: Scn8a
Vector Backbone Description: Vector Backbone:pcDNA3.1(+)-P2A-eGFP (P2A-eGFP was replaced by the HA tag); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37288813
Comments: A portion of this plasmid was derived from a plasmid made by GenScript.
Proper citation: RRID:Addgene_239770 Copy
Species: Mus musculus
Genetic Insert: Scn8a
Vector Backbone Description: Vector Backbone:pcDNA3.1(+)-P2A-eGFP (P2A-eGFP was replaced by the HA tag); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37288813
Comments: A portion of this plasmid was derived from a plasmid made by GenScript.
Proper citation: RRID:Addgene_239767 Copy
Species: Mus musculus
Genetic Insert: ASAP3
Vector Backbone Description: Vector Backbone:AAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39185175
Proper citation: RRID:Addgene_240052 Copy
Species: Mus musculus
Genetic Insert: Sema7A
Vector Backbone Description: Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39152101
Proper citation: RRID:Addgene_190644 Copy
Species: Mus musculus
Genetic Insert: Sema7A
Vector Backbone Description: Vector Backbone:pCAGIG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39152101
Proper citation: RRID:Addgene_190648 Copy
Species: Mus musculus
Genetic Insert: mcherry and miR Mm ATP10B
Vector Backbone Description: Backbone Marker:Wilson; Backbone Size:5154; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40676227
Proper citation: RRID:Addgene_216391 Copy
Species: Mus musculus
Genetic Insert: OCaMP
Vector Backbone Description: Vector Backbone:pAAV Ef1a FLP; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:42331843
Comments: Please visit https://doi.org/10.1101/2025.07.28.667269 for bioRxiv preprint.
Proper citation: RRID:Addgene_224936 Copy
Species: Mus musculus
Genetic Insert: mouse GSDMA3
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35545676
Proper citation: RRID:Addgene_218942 Copy
Species: Mus musculus
Genetic Insert: mouse gsdma2
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35545676
Proper citation: RRID:Addgene_218941 Copy
Species: Mus musculus
Genetic Insert: cis-regulatory elements 89763
Vector Backbone Description: Backbone Marker:AAVnergene; Backbone Size:2896; Vector Backbone:pAAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40403707
Proper citation: RRID:Addgene_236727 Copy
Species: Mus musculus
Genetic Insert: shFos_1
Vector Backbone Description: Vector Backbone:SGEP; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41401069
Proper citation: RRID:Addgene_239618 Copy
Species: Mus musculus
Genetic Insert: DNMT3A-DNMT3L-OrufIscB-KRK-KRAB
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40335752
Proper citation: RRID:Addgene_239836 Copy
Species: Mus musculus
Genetic Insert: Jarid2
Vector Backbone Description: Vector Backbone:pcDNA3.1-polyA; Vector Types:Mammalian Expression, In vitro transcription; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39482357
Proper citation: RRID:Addgene_223811 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
