Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: MS2 coat protein mNeonGreen fusion
Vector Backbone Description: Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37267110
Proper citation: RRID:Addgene_207581 Copy
Species: Homo sapiens
Genetic Insert: CALR ins5
Vector Backbone Description: Vector Backbone:pMSCV-IRES-GFP; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31462733
Proper citation: RRID:Addgene_214701 Copy
Species: Homo sapiens
Genetic Insert: mApple-6x Hp NC
Vector Backbone Description: Vector Backbone:SJ12 CMV-GFP; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38949658
Proper citation: RRID:Addgene_217376 Copy
Species: Homo sapiens
Genetic Insert: CDKN1A
Vector Backbone Description: Vector Backbone:pBABE; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38458201
Proper citation: RRID:Addgene_215077 Copy
Species: Homo sapiens
Genetic Insert: STING (N154S)
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26235147
Proper citation: RRID:Addgene_214153 Copy
Species: Homo sapiens
Genetic Insert: alpha-synuclein
Vector Backbone Description: Backbone Size:9893; Vector Backbone:HR'CS-G; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38335281
Proper citation: RRID:Addgene_215489 Copy
Species: Homo sapiens
Genetic Insert: alpha-synuclein
Vector Backbone Description: Backbone Size:9155; Vector Backbone:HR'CS-G; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38335281
Proper citation: RRID:Addgene_215488 Copy
Species: Homo sapiens
Genetic Insert: Ras-LOCKR-PL Key
Vector Backbone Description: Backbone Marker:Genscript; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38273065
Proper citation: RRID:Addgene_216503 Copy
Species: Homo sapiens
Genetic Insert: POLD1
Vector Backbone Description: Backbone Marker:Takara Bio; Vector Backbone:pRetroQ-C1; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38458201
Proper citation: RRID:Addgene_215139 Copy
Species: Homo sapiens
Genetic Insert: CALR wt
Vector Backbone Description: Vector Backbone:pMSCV-IRES-GFP; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31462733
Proper citation: RRID:Addgene_214699 Copy
Species: Homo sapiens
Genetic Insert: CCND1
Vector Backbone Description: Vector Backbone:pTRIPZ; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38458201
Proper citation: RRID:Addgene_215148 Copy
Species: Homo sapiens
Genetic Insert: HaloTag with internal PuroR cassette flanked by human LC3B locus sequences
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pFastBac dual; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37115157
Proper citation: RRID:Addgene_207539 Copy
Species: Homo sapiens
Genetic Insert: WDR20
Vector Backbone Description: Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37798301
Proper citation: RRID:Addgene_217618 Copy
Species: Homo sapiens
Genetic Insert: hTMEM115-TEV-3xHA-P2A-mScarlet HDR template
Vector Backbone Description: Vector Backbone:pTwist-Amp; Vector Types:HDR template; Bacterial Resistance:Ampicillin
Comments: Use either of the following guides: GTCTGGAGTTACAGCGTCGGGGG or CCGCTCATTGAGTGCCTTCAGGG (in both cases, the PAM is the final GGG) . Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/.
Proper citation: RRID:Addgene_214998 Copy
Species: Homo sapiens
Genetic Insert: hTMEM115-TEV-3xHA-P2A-mNeonGreen HDR template
Vector Backbone Description: Vector Backbone:pTwist-Amp; Vector Types:HDR template; Bacterial Resistance:Ampicillin
Comments: Use either of the following guides: GTCTGGAGTTACAGCGTCGGGGG or CCGCTCATTGAGTGCCTTCAGGG (in both cases, the PAM is the final GGG) . Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/.
Proper citation: RRID:Addgene_214999 Copy
Species: Homo sapiens
Genetic Insert: Ras-LOCKR-S
Vector Backbone Description: Backbone Marker:Genscript; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38273065
Proper citation: RRID:Addgene_216496 Copy
Species: Homo sapiens
Genetic Insert: CCND3
Vector Backbone Description: Vector Backbone:mAzamiGreen (Plasmid #54797); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38458201
Proper citation: RRID:Addgene_215061 Copy
Species: Homo sapiens
Genetic Insert: CCND1
Vector Backbone Description: Vector Backbone:mAzamiGreen (Plasmid #54797); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38458201
Proper citation: RRID:Addgene_215060 Copy
Species: Homo sapiens
Genetic Insert: CACTGAATACCAGCGCCTAG
Vector Backbone Description: Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37115157
Proper citation: RRID:Addgene_207557 Copy
Species: Homo sapiens
Genetic Insert: GLI3
Vector Backbone Description: Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36608654
Comments: NM_000168,ENST00000395925 . The transcription factor ORF portion of this plasmid was synthesized by Genewiz. Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence.
Proper citation: RRID:Addgene_143655 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
