Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Streptococcus pyogenes
Genetic Insert: SpCas9-KA (no stop codon)
Vector Backbone Description: Vector Backbone:pAGM1287; Vector Types:CRISPR; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:30811422
Comments: Compatible with MoClo, Loop Please visit https://www.biorxiv.org/content/early/2018/09/20/422766 for BioRxiv preprint
Proper citation: RRID:Addgene_117525 Copy
Species: Streptococcus pyogenes
Genetic Insert: Sp-eCas9 1.0 (no stop codon)
Vector Backbone Description: Vector Backbone:pAGM1287; Vector Types:CRISPR; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:30811422
Comments: Compatible with MoClo, Loop Please visit https://www.biorxiv.org/content/early/2018/09/20/422766 for BioRxiv preprint
Proper citation: RRID:Addgene_117527 Copy
Species: Homo sapiens
Genetic Insert: ALK4
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pCMV5B; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9748228
Proper citation: RRID:Addgene_11756 Copy
Species: Homo sapiens
Genetic Insert: NMT2
Vector Backbone Description: Vector Backbone:pMON; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:11771383
Comments: This plasmid also contains the gene that expresses E. coli methionine aminopeptidase under its own promoter
Proper citation: RRID:Addgene_117477 Copy
Species: Arabidopsis thaliana
Genetic Insert: BsaI:GGAG:pAG:AATG:BsaI
Vector Backbone Description: Backbone Size:2247; Vector Backbone:pICH41295; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:30625150
Comments: pICSL12022 carries GGAG-TACT golden gate ends. It has to be cloned with a 5’UTR plasmid, TACT-AATG, when assembled with a CDS and terminator into Level 1. For instance pICH41402 (plasmid 50285 on Addgene) can be used. This assembly of promoter / 5’UTR / CDS / terminator can be done in a single reaction.
Cloned by Laurence Tomlinson . Please visit https://www.biorxiv.org/content/early/2018/09/17/419952 for bioRxiv preprint.
Proper citation: RRID:Addgene_117510 Copy
Species: Homo sapiens
Genetic Insert: NMT1
Vector Backbone Description: Vector Backbone:pMON; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:11771383
Comments: This plasmid also contains the gene that expresses E. coli methionine aminopeptidase under its own promoter
Proper citation: RRID:Addgene_117476 Copy
Species: Arabidopsis thaliana
Genetic Insert: BsaI:GGAG:pRPS5a:AATG:BsaI
Vector Backbone Description: Backbone Size:2247; Vector Backbone:pICH41295; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:30625150
Comments: Cloned by Baptiste Castel . Please visit https://www.biorxiv.org/content/early/2018/09/17/419952 for bioRxiv preprint.
Proper citation: RRID:Addgene_117512 Copy
Vector Backbone Description: Backbone Marker:Yanisch-Perron et al.; Backbone Size:2860; Vector Backbone:pTZ18U; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:9514705
Proper citation: RRID:Addgene_117478 Copy
Species: Arabidopsis thaliana
Genetic Insert: BsaI:GGAG:pICU2:AATG:BsaI
Vector Backbone Description: Backbone Size:2247; Vector Backbone:pICH41295; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:30625150
Comments: Cloned by Laurence Tomlinson . Please visit https://www.biorxiv.org/content/early/2018/09/17/419952 for bioRxiv preprint.
Proper citation: RRID:Addgene_117511 Copy
Species: Homo sapiens
Genetic Insert: PSD4
Vector Backbone Description: Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_117473 Copy
Species: Synthetic
Genetic Insert: BpiI:ACTA:pU6-26:sgRNA-EF:t192bp:TTAC:BpiI
Vector Backbone Description: Backbone Size:4352; Vector Backbone:pICH47751; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30625150
Comments: Cloned by Laurence Tomlinson.
Primers to amplify a sgRNA:
Fw: ga GGTCTCa ATTG [x] GTTTAAGAGCTATGCTGGAA, where [x] is the 20nt spacer/target sequence (NOT including the PAM).
Rv: tgtggtctcaAGCGAAAAAAAGCACCGACTC (for polyT terminator)
tgtggtctcaAGCGACCCCAGAAATTGAAC (for 67 bp U6-26 terminator, recommanded)
tgtggtctcaAGCGTATTGGTTTATCTCATCG (for 192 bp U6-26 terminator).
The PCR amplicon is ready to clone in a Golden Gate fashion with U6-26 promoter (pICSL90002) and any Golden Gate compatible acceptor vector Level 1, using BsaI. Please visit https://www.biorxiv.org/content/early/2018/09/17/419952 for bioRxiv preprint.
Proper citation: RRID:Addgene_117518 Copy
Species: Synthetic
Genetic Insert: BpiI:ACTA:pU6-26:sgRNA:polyT:TTAC:BpiI
Vector Backbone Description: Backbone Size:4352; Vector Backbone:pICH47751; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30625150
Comments: Cloned by Laurence Tomlinson.
Primers to amplify a sgRNA:
Fw: ga GGTCTCa ATTG [x] GTTTTAGAGCTAGAAATAGC, where [x] is the 20nt spacer/target sequence (NOT including the PAM).
Rv: tgtggtctcaAGCGAAAAAAAGCACCGACTC.
The PCR amplicon is ready to clone in a Golden Gate fashion with U6-26 promoter (pICSL90002) and any Golden Gate compatible acceptor vector Level 1, using BsaI. Please visit https://www.biorxiv.org/content/early/2018/09/17/419952 for bioRxiv preprint.
Proper citation: RRID:Addgene_117517 Copy
Species: Pisum sativum
Genetic Insert: BsaI:GCTT:E9t:CGCT:BsaI
Vector Backbone Description: Backbone Size:2247; Vector Backbone:pICH41276; Vector Types:; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:30625150
Comments: Cloned by Laurence Tomlinson . Please visit https://www.biorxiv.org/content/early/2018/09/17/419952 for bioRxiv preprint.
Proper citation: RRID:Addgene_117519 Copy
Species: Synthetic
Genetic Insert: BsaI:AATG:Cas9_2:GCTT:BsaI
Vector Backbone Description: Backbone Size:2247; Vector Backbone:pICH41308; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:30625150
Comments: Cloned by Oleg Raitskin . Please visit https://www.biorxiv.org/content/early/2018/09/17/419952 for bioRxiv preprint.
Proper citation: RRID:Addgene_117514 Copy
Species: Desulfovibrio vulgaris
Genetic Insert: uracil phosphoribosyltransferase
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCR4/TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:23393089
Comments: Selection for kanamycin resistance after introduction of pMO746 identifies those cells in which integration into the chromosome of part or all of the plasmid has occurred.
Kanamycin resistance is a strong selection in the sulfate-reducing bacteria (SRB). Ampicillin is not universally effective in the SRB but is often used for selection in Escherichia coli. Thus this plasmid can be readily grown in E. coli but is actually unstable in the SRB.
Proper citation: RRID:Addgene_117480 Copy
Species: Homo sapiens
Genetic Insert: PSD2
Vector Backbone Description: Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_117466 Copy
Species: Arabidopsis thaliana
Genetic Insert: BsaI:GGAG:pMGE1:AATG:BsaI
Vector Backbone Description: Backbone Size:2247; Vector Backbone:pICH41295; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:30625150
Comments: Cloned by Baptiste Castel . Please visit https://www.biorxiv.org/content/early/2018/09/17/419952 for bioRxiv preprint.
Proper citation: RRID:Addgene_117509 Copy
Species: Synthetic
Genetic Insert: BpiI:tagt:UBI10:Cas9-3(intron):E9:ttgc:BpiI
Vector Backbone Description: Backbone Size:4352; Vector Backbone:pICH47811; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30625150
Comments: Cloned by Baptiste Castel . Please visit https://www.biorxiv.org/content/early/2018/09/17/419952 for bioRxiv preprint.
Proper citation: RRID:Addgene_117503 Copy
Species: Homo sapiens
Genetic Insert: PSD3
Vector Backbone Description: Vector Backbone:pcDNA-DEST42; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_117469 Copy
Species: Synthetic
Genetic Insert: BpiI:GCAA:UBI10:Cas9-3(intron):E9:ACTA:BpiI
Vector Backbone Description: Backbone Size:4352; Vector Backbone:pICH47742; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30625150
Comments: Cloned by Baptiste Castel . Please visit https://www.biorxiv.org/content/early/2018/09/17/419952 for bioRxiv preprint.
Proper citation: RRID:Addgene_117502 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
