Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pRK5-HA-SH3BP4 W92A Resource Report Resource Website |
RRID:Addgene_46893 | SH3BP4 W92A | Homo sapiens | Ampicillin | PMID:22575674 | Mutagenesis was performed using a site-directed mutagenesis kit (Stratagene) and the following primer: cacatctggcggtgaggcgtggtacgcacacaac | Backbone Marker:clonetch; Vector Backbone:pRK5-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | W92A (mutated SH3 domain) | 2026-09-01 09:55:36 | 0 |
|
pSNR52-sgTET Resource Report Resource Website |
RRID:Addgene_46923 | sgRNA targeting endogenous TRE elements of pTET07 promoter | Saccharomyces cerevisiae | Ampicillin | PMID:23849981 | gRNA target sequence TATCAGTGATAGAGAAAAGT | Backbone Size:5083; Vector Backbone:AH057; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:36 | 0 | |
|
pMA3288 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46885 | Uracil-N-glycosylase WT | Homo sapiens | Ampicillin | PMID:23721969 | Backbone Marker:Homemade; Backbone Size:6686; Vector Backbone:pMA2780; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:36 | 1 | ||
|
pMSP3535 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46886 | Erythromycin | PMID:10964628 | This plasmid utilizes the NIsin Controlled Expression (NICE) system. NICE® is a registered trademark of NIZO food research BV, P.O.Box 20, 6710 BA Ede, The Netherlands. pMSP3535 contains the Nisin-inducible PnisA promoter, and the pAMB1 replicon for expression in gram-positive bacteria. For protein expression in E. faecalis, induce with 10-25 ng/mL nisin (Sigma, N-5764). See associated article for instructions on how to make nisin solution. Note: Nucleotide sequence encoding the signal sequence and one-third of the mature NisA (nisin) peptide remains associated with the PnisA promoter. The depositing laboratory recommends adding of a Stop codon to the 5' end of inserted sequences to avoid unintentional gene fusions. Addgene's quality control sequencing finds discrepancies with the depositor's provided sequencew which includes a mutation in RepE- F229L. This however is thought to not affect plasmid function. | Backbone Size:8353; Vector Backbone:pMSP3535; Vector Types:Bacterial Expression, Nisin-inducible expression; Gram-positive Bacterial Shuttle Vector; Bacterial Resistance:Erythromycin | 2026-09-01 09:55:36 | 6 | |||
|
pMSP3535VA Resource Report Resource Website 1+ mentions |
RRID:Addgene_46887 | Kanamycin | PMID:10964628 | This plasmid utilizes the NIsin Controlled Expression (NICE) system. NICE® is a registered trademark of NIZO food research BV, P.O.Box 20, 6710 BA Ede, The Netherlands. pMSP3535VA contains the Nisin-inducible PnisA promoter, and the pVA380-1 replicon for expression in gram-positive bacteria. For protein expression in E. faecalis, induce with 10-25 ng/mL nisin (Sigma, N-5764). See associated article for instructions on how to make nisin solution. Note: Nucleotide sequence encoding the signal sequence and one-third of the mature NisA (nisin) peptide remains associated with the PnisA promoter. The depositing laboratory recommends adding of a Stop codon to the 5' end of inserted sequences to avoid unintentional gene fusions. Note: The theoretical full sequence uploaded here is NOT fully accurate - the NheI site at position 4414 has been lost, along with approximately 500bp of sequence in this region (compare the depositor's uploaded maps). The actual size of this plasmid is 8278 as listed here. The depositing lab has not resequenced the region in question, but the discrepancy does not affect plasmid function. Note: This plasmid has been shown to accumulate deletions when replicated in E. coli (or gram-negative bacteria). Screening transformants by restriction digest is recommended. Addgene's quality control sequencing finds discrepancies with the depositor's provided sequence, but they are not thought to affect plasmid function. | Backbone Size:8278; Vector Backbone:pMSP3535VA; Vector Types:Bacterial Expression, Nisin-inducible expression; Gram-positive Bacterial Shuttle Vector; Bacterial Resistance:Kanamycin | 2026-09-01 09:55:36 | 1 | |||
|
pTDH3-dCas9 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46920 | dCas9 | Ampicillin | PMID:23849981 | The Cas9 contains a N612K mutation that does not effect the function of the enzyme. | Backbone Size:6900; Vector Backbone:pJED103; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:36 | 7 | ||
|
pMA3174 Resource Report Resource Website |
RRID:Addgene_46880 | Ampicillin | PMID:22637478 | Backbone Marker:Homemade; Backbone Size:6990; Vector Backbone:pMA3211; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:36 | 0 | ||||
|
pU6-sgGFP-NT1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46914 | sgGFP-NT1 | Ampicillin | PMID:23849981 | gRNA target sequence GAATAGCTCAGAGGCCGAGG | Backbone Marker:Addgene; Backbone Size:8200; Vector Backbone:pSICO derivative; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:36 | 8 | ||
|
pU6-sgGAL4-1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46915 | sgGAL4-1 | Ampicillin | PMID:23849981 | gRNA target sequence GTTGGAGCACTGTCCTCCGAACGT | Backbone Marker:Addgene; Backbone Size:8200; Vector Backbone:pSICO derivative; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:36 | 2 | ||
|
pMA3211 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46879 | Ampicillin | PMID:22637478 | Backbone Marker:Homemade; Backbone Size:6642; Vector Backbone:pMA3211; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:36 | 1 | ||||
|
pMSCV-LTR-dCas9-p65AD-BFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_46913 | dCas9-p65AD-BFP fusion | Homo sapiens | Ampicillin | PMID:23849981 | Backbone Marker:Clontech; Backbone Size:6300; Vector Backbone:MSCV-puro; Vector Types:Mammalian Expression, Retroviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:36 | 2 | ||
|
pU6-sgCD71-2 Resource Report Resource Website |
RRID:Addgene_46918 | sgCD71 -2 | Homo sapiens | Ampicillin | PMID:23849981 | gRNA target sequence GGACGCGCTAGTGTGAGTGC | Backbone Marker:Addgene; Backbone Size:8200; Vector Backbone:pSICO derivative; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:36 | 0 | |
|
pU6-sgGAL4-4 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46916 | sgGAL4-4 | Ampicillin | PMID:23849981 | gRNA target sequence GAACGACTAGTTAGGCGTGTA | Backbone Marker:Addgene; Backbone Size:8200; Vector Backbone:pSICO derivative; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:36 | 1 | ||
|
pMA3379 Resource Report Resource Website |
RRID:Addgene_46874 | soluble guanylate cyclase 1alpha3 | Rattus norvegicus | Ampicillin | PMID:22637478 | Please note that though there are some differences between Addgene's quality control sequence and the depositor's assembled sequence, this plasmid should function as reported. | Backbone Marker:Homemade; Backbone Size:6642; Vector Backbone:pMA3211; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:36 | 0 | |
|
pMA3411 Resource Report Resource Website |
RRID:Addgene_46877 | soluble guanylate cyclase1 beta 3 | Rattus norvegicus | Ampicillin | PMID:22637478 | Backbone Size:5684; Vector Backbone:pMA1662; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | E473K, C541D | 2026-09-01 09:55:36 | 0 | |
|
pRK5-EGFP-Tau E14 P301L Resource Report Resource Website 1+ mentions |
RRID:Addgene_46909 | Tau E14 P301L | Homo sapiens | Ampicillin | PMID:21172610 | WT htau construct (Addgene plasmid 46904) was used as a template to make mutations and contains human four-repeat tau lacking the N-terminal sequences (4R0N) and contains exons 1, 4 and 5, 7, and 9–13, intron 13, and exon 14. | Backbone Marker:Clontech; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | P301L AND all 14 S/P or T/P amino acid residues (T111, T153, T175, T181, S199, S202, T205, T212, T217, T231, S235, S396, S404, and S422; numbering based on the longest 441-amino acid brain isoform of htau) changed to glutamate | 2026-09-01 09:55:36 | 2 |
|
pRK5-EGFP-Tau E14 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46907 | Tau E14 | Homo sapiens | Ampicillin | PMID:21172610 | WT htau construct (Addgene plasmid 46904) was used as a template to make mutations and contains human four-repeat tau lacking the N-terminal sequences (4R0N) and contains exons 1, 4 and 5, 7, and 9–13, intron 13, and exon 14. | Backbone Marker:Clontech; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | all 14 S/P or T/P amino acid residues (T111, T153, T175, T181, S199, S202, T205, T212, T217, T231, S235, S396, S404, and S422; numbering based on the longest 441-amino acid brain isoform of htau) to glutamate | 2026-09-01 09:55:36 | 7 |
|
pRK5-EGFP-Tau AP P301L Resource Report Resource Website 1+ mentions |
RRID:Addgene_46906 | Tau AP P301L | Homo sapiens | Ampicillin | PMID:21172610 | WT htau construct (Addgene plasmid 46904) was used as a template to make mutations and contains human four-repeat tau lacking the N-terminal sequences (4R0N) and contains exons 1, 4 and 5, 7, and 9–13, intron 13, and exon 14. | Backbone Marker:Clontech; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | P301L AND all 14 S/P or T/P amino acid residues (T111, T153, T175, T181, S199, S202, T205, T212, T217, T231, S235, S396, S404, and S422; numbering based on the longest 441-amino acid brain isoform of htau) changed to alanine | 2026-09-01 09:55:36 | 1 |
|
pCMV4Neo-murine IL-17RASEFIR-HA Resource Report Resource Website |
RRID:Addgene_46863 | IL-17RA-delta-SEFIR | Mus musculus | Ampicillin | PMID:17456598 | Backbone Size:5750; Vector Backbone:pCMV4-Neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Deletion of SEFIR domain (AA 394-485) | 2026-09-01 09:55:36 | 0 | |
|
pCMV4-Flag-mIL-17RA/CFP.Hygro Resource Report Resource Website |
RRID:Addgene_46861 | IL-17RA-CFP | Mus musculus | Ampicillin | PMID:17456598 | Backbone Size:6473; Vector Backbone:pCMV4-Hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:36 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.