Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pHAGE-UBC-MCP-mNeonGreen Resource Report Resource Website |
RRID:Addgene_207581 | MS2 coat protein mNeonGreen fusion | Homo sapiens | Ampicillin | PMID:37267110 | Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:20:18 | 0 | ||
|
pMSCV-IRES-GFP/CALR ins5 Resource Report Resource Website |
RRID:Addgene_214701 | CALR ins5 | Homo sapiens | Ampicillin | PMID:31462733 | Vector Backbone:pMSCV-IRES-GFP; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:20:15 | 0 | ||
|
Lenti-mApple-6xHp Resource Report Resource Website |
RRID:Addgene_217376 | mApple-6x Hp NC | Homo sapiens | Ampicillin | PMID:38949658 | Vector Backbone:SJ12 CMV-GFP; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:20:15 | 0 | ||
|
p21-mCerulean-PuroR Resource Report Resource Website |
RRID:Addgene_215077 | CDKN1A | Homo sapiens | Ampicillin | PMID:38458201 | Vector Backbone:pBABE; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:20:17 | 0 | ||
|
pcDNA3.1-hSTING (N154S) Resource Report Resource Website |
RRID:Addgene_214153 | STING (N154S) | Homo sapiens | Ampicillin | PMID:26235147 | Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | N154S | 2026-08-29 01:20:17 | 0 | |
|
FUW-hSNCA-GFP Resource Report Resource Website |
RRID:Addgene_215489 | alpha-synuclein | Homo sapiens | Ampicillin | PMID:38335281 | Backbone Size:9893; Vector Backbone:HR'CS-G; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:20:18 | 0 | ||
|
FUW-hSNCA(D2E)-NE Resource Report Resource Website |
RRID:Addgene_215488 | alpha-synuclein | Homo sapiens | Ampicillin | PMID:38335281 | Backbone Size:9155; Vector Backbone:HR'CS-G; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | D (second aa) mutated to E | 2026-08-29 01:20:15 | 0 | |
|
pcDNA3 Ras-LOCKR-PL Key Resource Report Resource Website 1+ mentions |
RRID:Addgene_216503 | Ras-LOCKR-PL Key | Homo sapiens | Ampicillin | PMID:38273065 | Backbone Marker:Genscript; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:20:18 | 1 | ||
|
mCherry-POLD1 Resource Report Resource Website |
RRID:Addgene_215139 | POLD1 | Homo sapiens | Ampicillin | PMID:38458201 | Backbone Marker:Takara Bio; Vector Backbone:pRetroQ-C1; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:20:18 | 0 | ||
|
pMSCV-IRES-GFP/CALR wt Resource Report Resource Website |
RRID:Addgene_214699 | CALR wt | Homo sapiens | Ampicillin | PMID:31462733 | Vector Backbone:pMSCV-IRES-GFP; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:20:18 | 0 | ||
|
pTRIPZ-FFSS-Cyclin D1 Resource Report Resource Website |
RRID:Addgene_215148 | CCND1 | Homo sapiens | Ampicillin | PMID:38458201 | Vector Backbone:pTRIPZ; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:20:15 | 0 | ||
|
Halo-LC3B HRD Resource Report Resource Website |
RRID:Addgene_207539 | HaloTag with internal PuroR cassette flanked by human LC3B locus sequences | Homo sapiens | Ampicillin | PMID:37115157 | Backbone Size:5500; Vector Backbone:pFastBac dual; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:20:18 | 0 | ||
|
Human FLAG-WDR20 Resource Report Resource Website |
RRID:Addgene_217618 | WDR20 | Homo sapiens | Ampicillin | PMID:37798301 | Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:20:15 | 0 | ||
|
hTMEM115-TEV-3xHA-P2A-mScarlet HDR template Resource Report Resource Website |
RRID:Addgene_214998 | hTMEM115-TEV-3xHA-P2A-mScarlet HDR template | Homo sapiens | Ampicillin | Use either of the following guides: GTCTGGAGTTACAGCGTCGGGGG or CCGCTCATTGAGTGCCTTCAGGG (in both cases, the PAM is the final GGG) . Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/. | Vector Backbone:pTwist-Amp; Vector Types:HDR template; Bacterial Resistance:Ampicillin | 2026-08-29 01:20:14 | 0 | ||
|
hTMEM115-TEV-3xHA-P2A-mNeonGreen HDR template Resource Report Resource Website |
RRID:Addgene_214999 | hTMEM115-TEV-3xHA-P2A-mNeonGreen HDR template | Homo sapiens | Ampicillin | Use either of the following guides: GTCTGGAGTTACAGCGTCGGGGG or CCGCTCATTGAGTGCCTTCAGGG (in both cases, the PAM is the final GGG) . Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/. | Vector Backbone:pTwist-Amp; Vector Types:HDR template; Bacterial Resistance:Ampicillin | 2026-08-29 01:20:17 | 0 | ||
|
pcDNA3 Ras-LOCKR-S Resource Report Resource Website 1+ mentions |
RRID:Addgene_216496 | Ras-LOCKR-S | Homo sapiens | Ampicillin | PMID:38273065 | Backbone Marker:Genscript; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:20:18 | 1 | ||
|
mAzGreen-Cyclin D3-NeoR Resource Report Resource Website |
RRID:Addgene_215061 | CCND3 | Homo sapiens | Kanamycin | PMID:38458201 | Vector Backbone:mAzamiGreen (Plasmid #54797); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:20:15 | 0 | ||
|
mAzGreen-Cyclin D1-NeoR Resource Report Resource Website |
RRID:Addgene_215060 | CCND1 | Homo sapiens | Kanamycin | PMID:38458201 | Vector Backbone:mAzamiGreen (Plasmid #54797); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:20:15 | 0 | ||
|
ATG9A sgRNA Resource Report Resource Website |
RRID:Addgene_207557 | CACTGAATACCAGCGCCTAG | Homo sapiens | Ampicillin | PMID:37115157 | Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:20:15 | 0 | ||
|
TFORF2886 Resource Report Resource Website |
RRID:Addgene_143655 | GLI3 | Homo sapiens | Ampicillin | PMID:36608654 | NM_000168,ENST00000395925 . The transcription factor ORF portion of this plasmid was synthesized by Genewiz. Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence. | Backbone Marker:Broad Institute Genetic Perturbation Platform; Backbone Size:8264; Vector Backbone:pLX_TRC317; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:20:19 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
