Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 453 showing 9041 ~ 9060 out of 178,636 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/46867

Species: Mus musculus
Genetic Insert: 24p3/lipocalin 2 proximal promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17456598

Proper citation: RRID:Addgene_46867 Copy   


http://www.addgene.org/46865

Species: Mus musculus
Genetic Insert: 24p3/lipocalin 2 proximal promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17456598

Proper citation: RRID:Addgene_46865 Copy   


  • RRID:Addgene_47028

    This resource has 1+ mentions.

http://www.addgene.org/47028

Species: Mus musculus
Genetic Insert: Brn4
Vector Backbone Description: Backbone Size:5871; Vector Backbone:pMX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22445517

Proper citation: RRID:Addgene_47028 Copy   


  • RRID:Addgene_46971

    This resource has 10+ mentions.

http://www.addgene.org/46971

Species: Homo sapiens
Genetic Insert: Bcl2
Vector Backbone Description: Backbone Marker:System Biosciences; Vector Backbone:PCDH-CMV-MCS-EF1-PURO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23403638
Comments: Bcl-2 was cut from 3544 pMIG Bcl-2 (Addgene #8793) and subcloned into the EcoRI sites of pCDH-CMV-MCS-EF1-Puro.

Proper citation: RRID:Addgene_46971 Copy   


  • RRID:Addgene_47023

    This resource has 1+ mentions.

http://www.addgene.org/47023

Species: Mus musculus
Genetic Insert: Mu L1+L2
Vector Backbone Description: Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22985477

Proper citation: RRID:Addgene_47023 Copy   


  • RRID:Addgene_46961

    This resource has 1+ mentions.

http://www.addgene.org/46961

Species: Homo sapiens
Genetic Insert: human Ku70
Vector Backbone Description: Backbone Size:5044; Vector Backbone:pICE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23897892

Proper citation: RRID:Addgene_46961 Copy   


  • RRID:Addgene_46966

    This resource has 10+ mentions.

http://www.addgene.org/46966

Species: Synthetic
Genetic Insert: AtU6p::sgRNA_PDS
Vector Backbone Description: Backbone Size:6340; Vector Backbone:pICH86966; Vector Types:CRISPR, Plant expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23929340
Comments: gRNA target sequence GCCGTTAATTTGAGAGTCCA

Proper citation: RRID:Addgene_46966 Copy   


  • RRID:Addgene_46963

    This resource has 1+ mentions.

http://www.addgene.org/46963

Species: Physarum polycephalum
Genetic Insert: NLS-I-PpoI
Vector Backbone Description: Backbone Size:5044; Vector Backbone:pICE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23897892

Proper citation: RRID:Addgene_46963 Copy   


  • RRID:Addgene_47096

http://www.addgene.org/47096

Species: Homo sapiens
Genetic Insert: DAH
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4674; Vector Backbone:pET12a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_47096 Copy   


  • RRID:Addgene_47097

http://www.addgene.org/47097

Species: Homo sapiens
Genetic Insert: HAL
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4674; Vector Backbone:pET12a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_47097 Copy   


  • RRID:Addgene_47094

http://www.addgene.org/47094

Species: Homo sapiens
Genetic Insert: AL-103 Y96F
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4674; Vector Backbone:pET12a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22740699

Proper citation: RRID:Addgene_47094 Copy   


http://www.addgene.org/47095

Species: Homo sapiens
Genetic Insert: AL-103 delProIns
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4674; Vector Backbone:pET12a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_47095 Copy   


  • RRID:Addgene_47098

http://www.addgene.org/47098

Species: Homo sapiens
Genetic Insert: JOH1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4674; Vector Backbone:pET12a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_47098 Copy   


http://www.addgene.org/47092

Species: Homo sapiens
Genetic Insert: AL-103 Y32F Y96F
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4674; Vector Backbone:pET12a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22740699

Proper citation: RRID:Addgene_47092 Copy   


  • RRID:Addgene_47093

http://www.addgene.org/47093

Species: Homo sapiens
Genetic Insert: AL-103 Y91F
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4674; Vector Backbone:pET12a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22740699

Proper citation: RRID:Addgene_47093 Copy   


  • RRID:Addgene_47090

http://www.addgene.org/47090

Species: Homo sapiens
Genetic Insert: AL-103
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4674; Vector Backbone:pET12a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21077798

Proper citation: RRID:Addgene_47090 Copy   


  • RRID:Addgene_47091

http://www.addgene.org/47091

Species: Homo sapiens
Genetic Insert: AL-103 Y32F
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4674; Vector Backbone:pET12a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22740699

Proper citation: RRID:Addgene_47091 Copy   


  • RRID:Addgene_46956

    This resource has 1+ mentions.

http://www.addgene.org/46956

Species: Synthetic
Genetic Insert: FLAG tag
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23897892

Proper citation: RRID:Addgene_46956 Copy   


  • RRID:Addgene_46957

    This resource has 10+ mentions.

http://www.addgene.org/46957

Species: Homo sapiens
Genetic Insert: Ku70
Vector Backbone Description: Backbone Size:4766; Vector Backbone:pEGFP-C1-FLAG; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23897892

Proper citation: RRID:Addgene_46957 Copy   


  • RRID:Addgene_46950

    This resource has 1+ mentions.

http://www.addgene.org/46950

Species: Homo sapiens
Genetic Insert: HPV52L1+L2
Vector Backbone Description: Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18360909

Proper citation: RRID:Addgene_46950 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X