Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: CDKN2BAS enhancer
Vector Backbone Description: Backbone Marker:Ferrer Lab; Backbone Size:4283; Vector Backbone:pGL4.23-GW; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24413736
Comments: chromosome : chr9; start: 22123613 end: 22124279 (genomic position corresponds to the version of the human genome hg18)
Fw primer used for cloning: CACCTCTGCATAAATTCTTTGGAACA Rv primer used for cloning: GATCCACCCACCTTGGTTTCC
Proper citation: RRID:Addgene_60296 Copy
Genetic Insert: sgRNA
Vector Backbone Description: Backbone Size:2738; Vector Backbone:AAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25263330
Comments: Information for Cas9 mice:
JAX Stock#024857 B6.129S-Gt(ROSA)26Sor
Proper citation: RRID:Addgene_60225 Copy
Genetic Insert: sgRNA
Vector Backbone Description: Backbone Size:2597; Vector Backbone:AAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25263330
Comments: Information for Cas9 mice:
JAX Stock#024857 B6.129S-Gt(ROSA)26Sor
Proper citation: RRID:Addgene_60228 Copy
Genetic Insert: sgRNA
Vector Backbone Description: Backbone Size:2597; Vector Backbone:AAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25263330
Comments: Information for Cas9 mice:
JAX Stock#024857 B6.129S-Gt(ROSA)26Sor
Proper citation: RRID:Addgene_60227 Copy
Genetic Insert: sgRNA
Vector Backbone Description: Backbone Size:2597; Vector Backbone:AAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25263330
Comments: Information for Cas9 mice:
JAX Stock#024857 B6.129S-Gt(ROSA)26Sor
Proper citation: RRID:Addgene_60226 Copy
Species: Mus musculus
Genetic Insert: TUT4
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25175028
Proper citation: RRID:Addgene_60220 Copy
Species: Homo sapiens
Genetic Insert: Argonaute2
Vector Backbone Description: Backbone Size:13918; Vector Backbone:pSLIK-Hygro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22503104
Proper citation: RRID:Addgene_60234 Copy
Genetic Insert: inmCherry
Vector Backbone Description: Backbone Size:6587; Vector Backbone:pUCHR; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26269177
Proper citation: RRID:Addgene_60239 Copy
Genetic Insert: inmCherry
Vector Backbone Description: Backbone Size:6419; Vector Backbone:pUCHR; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26269177
Proper citation: RRID:Addgene_60238 Copy
Genetic Insert: sgRNA
Vector Backbone Description: Backbone Size:2597; Vector Backbone:AAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25263330
Comments: Information for Cas9 mice:
JAX Stock#024857 B6.129S-Gt(ROSA)26Sor
Proper citation: RRID:Addgene_60231 Copy
Genetic Insert: sgRNA
Vector Backbone Description: Backbone Size:2597; Vector Backbone:AAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25263330
Comments: Information for Cas9 mice:
JAX Stock#024857 B6.129S-Gt(ROSA)26Sor
Proper citation: RRID:Addgene_60230 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: TUB2
Vector Backbone Description: Vector Backbone:pRS424; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24633327
Proper citation: RRID:Addgene_60401 Copy
Species: Escherichia coli
Genetic Insert: RNase HI-D10R-E48R
Vector Backbone Description: Backbone Size:5044; Vector Backbone:pICE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25030905
Proper citation: RRID:Addgene_60367 Copy
Vector Backbone Description: Backbone Size:4384; Vector Backbone:pBAM1; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:21342504
Proper citation: RRID:Addgene_60487 Copy
Species: Escherichia coli
Genetic Insert: RNase HI
Vector Backbone Description: Backbone Size:5044; Vector Backbone:pICE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25030905
Proper citation: RRID:Addgene_60365 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: TUB2
Vector Backbone Description: Vector Backbone:pRS424; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24633327
Comments: C-terminal tail is from TUBB6 (tubulin, beta 6 class V) according to HUGO nomenclature: http://www.genenames.org/genefamilies/TUB
Proper citation: RRID:Addgene_60403 Copy
Species: A. sativa, E. coli
Genetic Insert: iLID C530M
Vector Backbone Description: Backbone Marker:Qiagen; Backbone Size:4800; Vector Backbone:pQE-80L; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25535392
Proper citation: RRID:Addgene_60408 Copy
Species: Mus musculus
Genetic Insert: GMAP210
Vector Backbone Description: Backbone Marker:Sigma; Vector Backbone:p3XFLAG-myc-CMV-26; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19112494
Proper citation: RRID:Addgene_60407 Copy
Species: Homo sapiens
Genetic Insert: KIF17
Vector Backbone Description: Vector Backbone:pHR; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24633327
Proper citation: RRID:Addgene_60406 Copy
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4733; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25030905
Proper citation: RRID:Addgene_60360 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.