Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Mentions:yes (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

32,424 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pAB1678 CMV-HIVNES-GS-Cas13bt1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_176316 human codon optimized Cas13bt1 Atlantic deep subsurface metagenome Ampicillin PMID:34462587 Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-09-01 09:29:55 1
pGST1-Osh4 (2-434)
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_17632 Osh4 Saccharomyces cerevisiae Ampicillin PMID:16136145 DNA encoding Osh4 residues 2–434 was amplified by PCR and subcloned into the BamHI and XhoI sites of a pGEX-4T vector modified to contain a TEV protease recognition site. Backbone Size:5000; Vector Backbone:modified pGEX-4T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:29:55 1
pGFP-Ub-VPS13D
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_176462 VPS13D Homo sapiens Kanamycin PMID:33891012 GFP-Ub-VPS13D will be translated into one fusion protein. However, endogenous DUBs will cleave it into GFP-Ub and VPS13D fragments. GFP-Ub hence acts as a fluorescent reporter for VPS13D expression. Backbone Marker:Clontech; Backbone Size:3679; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-09-01 09:29:58 1
GFP-Trim46
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_176402 trim46 Mus musculus Ampicillin PMID:26671463 Vector Backbone:?pGW1-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:29:57 2
pGST2-Alix (360-702)
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_17639 Alix (360-702) Homo sapiens Ampicillin PMID:17277784 The vector backbone, parallel GST2, was made by replacing the polylinker of pGEX4T1 with the polylinker isolated from the baculovirus expression plasmid pFastBac (see PMID: 10024467). Backbone Size:5000; Vector Backbone:parallel GST2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Alix V domain 2026-09-01 09:29:57 1
pcDNA3-myc-his-BACH1 K52R
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_17643 BACH1 Homo sapiens Ampicillin PMID:14983014 Backbone Marker:Invitrogen; Backbone Size:5493; Vector Backbone:pcDNA3.1(+)/myc-His A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin The lysine residue at position 52 was changed to an arginine, using a Quik-change site-directed mutagenesis kit (Stratagene). 2026-09-01 09:29:57 2
pCMV-Tag1-NS5A
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_17646 HCV NS5A Hepatitis C virus Kanamycin PMID:17404395 Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMVTag1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-09-01 09:29:58 4
Flag-hCRM1
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_17647 CRM1 Homo sapiens Ampicillin PMID:16041368 Backbone Marker:Sigma; Backbone Size:6400; Vector Backbone:p3xFLAG CMV-10; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:29:58 14
pCS2-MT GLI2 delta N
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_17649 GLI2 Homo sapiens Ampicillin PMID:15994174 Backbone Size:4350; Vector Backbone:pCS2-MT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Missing 328 N-terminal amino acids 2026-09-01 09:29:58 12
pET29b-mVenus-dspB(E184Q W330Y)-6xHis
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_176577 Dispersin B Aggregatibacter actinomycetemcomitans Kanamycin PMID:35379435 Backbone Size:5313; Vector Backbone:pET29b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin E184Q W330Y 2026-09-01 09:30:00 1
BL21 Rosetta2 ΔrecBCD
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_176583 pRARE2 plasmid Chloramphenicol PMID:35034449 Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recBCD deletion verification: Foward - ttgatttactgcccgagagc Reverse - gtcaaccgaatgcagacatc Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol recBCD genomic deletion 2026-09-01 09:30:00 1
pCDH-EF1-mVenus-p27K−
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_176651 mVenus-p27K- Mus musculus Ampicillin PMID:34079127 Backbone Marker:System Biosciences; Backbone Size:7082; Vector Backbone:pCDH; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin Mutant K- (lacks affinity to Cdk) 2026-09-01 09:30:01 5
GFP-HP1beta
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_17651 HP1 beta Homo sapiens Ampicillin PMID:12560555 See author's map for more information. Backbone Marker:Zentgraf Lab; Backbone Size:0; Vector Backbone:pBCHGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:29:59 8
GFP-HP1alpha
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_17652 HP1 alpha Homo sapiens Ampicillin PMID:12560555 See author's map for more information. Backbone Marker:Zentgraf Lab; Backbone Size:0; Vector Backbone:pBCHGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:29:59 20
pEGFP-D50 lamin A
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_17653 D50 lamin A Homo sapiens Kanamycin PMID:15750600 Backbone Marker:Clontech; Backbone Size:4730; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Delta 50 (50 aa internal deletion in globular tail domain) 2026-09-01 09:29:59 14
pHS0570 pET45b(+) T7/LacO His14-MBP-bdSUMO-CRISPR associated IscB-TwinStrep
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_176534 CRISPR-associated IscB (Delaware Bay metagenome) E. coli, Brachypodium distachyon, Delaware Bay metagenome Ampicillin PMID:34591643 Backbone Size:5062; Vector Backbone:pET45b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:29:59 2
Lac-I-SceI-Tet
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_17655 lac I-SceI tet Ampicillin PMID:17486118 The 256 lac operator repeats (XhoI fragment) and the 96 tet operator repeats (XhoI –SacII fragment) from the p16PCbeta plasmid (gift from D. Spector) were cloned into pBluescript. Between the two fragments a single 18nt I-SceI site was inserted (SalI). lac operator repeat: tggaattgtgagcggataacaatt tet operator repeat: tccctatcagtgatagaga This plasmid is not stable in bacteria. Every bacterial stock made will contain correct and incorrect bacteria and when bacteria are grown, you will get colonies which contain the correct plasmid and others which contain recombinant versions. If you check multiple colonies (10-20) in the samples after streaking out a stab, you should find correct ones. The recipient will need to grow the bacteria, isolate individual colonies check them, and make a prep from the correct one. We recommend processing the stab and screening colonies immediately upon receipt. Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:29:59 4
GFP-UBF
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_17656 UBF Homo sapiens Kanamycin PMID:12446911 Backbone Marker:Clontech; Backbone Size:4730; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-09-01 09:29:59 10
GFP-RPA194
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_17660 RPA194 Mus musculus Kanamycin PMID:12446911 Backbone Size:4730; Vector Backbone:modified pEGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-09-01 09:30:00 2
GFP-RRN3/TIF1A
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_17661 RRN3/TIF1A Homo sapiens Kanamycin PMID:12446911 Please note: This plasmid contains a F236L mutation in RRN3 compared to the NCBI reference sequence. It is not known how this mutation affects plasmid function. Backbone Marker:Clontech; Backbone Size:4730; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin See depositor comments below 2026-09-01 09:30:00 1

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.