Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pAB1678 CMV-HIVNES-GS-Cas13bt1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_176316 | human codon optimized Cas13bt1 | Atlantic deep subsurface metagenome | Ampicillin | PMID:34462587 | Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-09-01 09:29:55 | 1 | ||
|
pGST1-Osh4 (2-434) Resource Report Resource Website 1+ mentions |
RRID:Addgene_17632 | Osh4 | Saccharomyces cerevisiae | Ampicillin | PMID:16136145 | DNA encoding Osh4 residues 2–434 was amplified by PCR and subcloned into the BamHI and XhoI sites of a pGEX-4T vector modified to contain a TEV protease recognition site. | Backbone Size:5000; Vector Backbone:modified pGEX-4T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:29:55 | 1 | |
|
pGFP-Ub-VPS13D Resource Report Resource Website 1+ mentions |
RRID:Addgene_176462 | VPS13D | Homo sapiens | Kanamycin | PMID:33891012 | GFP-Ub-VPS13D will be translated into one fusion protein. However, endogenous DUBs will cleave it into GFP-Ub and VPS13D fragments. GFP-Ub hence acts as a fluorescent reporter for VPS13D expression. | Backbone Marker:Clontech; Backbone Size:3679; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-09-01 09:29:58 | 1 | |
|
GFP-Trim46 Resource Report Resource Website 1+ mentions |
RRID:Addgene_176402 | trim46 | Mus musculus | Ampicillin | PMID:26671463 | Vector Backbone:?pGW1-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:29:57 | 2 | ||
|
pGST2-Alix (360-702) Resource Report Resource Website 1+ mentions |
RRID:Addgene_17639 | Alix (360-702) | Homo sapiens | Ampicillin | PMID:17277784 | The vector backbone, parallel GST2, was made by replacing the polylinker of pGEX4T1 with the polylinker isolated from the baculovirus expression plasmid pFastBac (see PMID: 10024467). | Backbone Size:5000; Vector Backbone:parallel GST2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Alix V domain | 2026-09-01 09:29:57 | 1 |
|
pcDNA3-myc-his-BACH1 K52R Resource Report Resource Website 1+ mentions |
RRID:Addgene_17643 | BACH1 | Homo sapiens | Ampicillin | PMID:14983014 | Backbone Marker:Invitrogen; Backbone Size:5493; Vector Backbone:pcDNA3.1(+)/myc-His A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | The lysine residue at position 52 was changed to an arginine, using a Quik-change site-directed mutagenesis kit (Stratagene). | 2026-09-01 09:29:57 | 2 | |
|
pCMV-Tag1-NS5A Resource Report Resource Website 1+ mentions |
RRID:Addgene_17646 | HCV NS5A | Hepatitis C virus | Kanamycin | PMID:17404395 | Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMVTag1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-09-01 09:29:58 | 4 | ||
|
Flag-hCRM1 Resource Report Resource Website 10+ mentions |
RRID:Addgene_17647 | CRM1 | Homo sapiens | Ampicillin | PMID:16041368 | Backbone Marker:Sigma; Backbone Size:6400; Vector Backbone:p3xFLAG CMV-10; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:29:58 | 14 | ||
|
pCS2-MT GLI2 delta N Resource Report Resource Website 10+ mentions |
RRID:Addgene_17649 | GLI2 | Homo sapiens | Ampicillin | PMID:15994174 | Backbone Size:4350; Vector Backbone:pCS2-MT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Missing 328 N-terminal amino acids | 2026-09-01 09:29:58 | 12 | |
|
pET29b-mVenus-dspB(E184Q W330Y)-6xHis Resource Report Resource Website 1+ mentions |
RRID:Addgene_176577 | Dispersin B | Aggregatibacter actinomycetemcomitans | Kanamycin | PMID:35379435 | Backbone Size:5313; Vector Backbone:pET29b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | E184Q W330Y | 2026-09-01 09:30:00 | 1 | |
|
BL21 Rosetta2 ΔrecBCD Resource Report Resource Website 1+ mentions |
RRID:Addgene_176583 | pRARE2 plasmid | Chloramphenicol | PMID:35034449 | Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recBCD deletion verification: Foward - ttgatttactgcccgagagc Reverse - gtcaaccgaatgcagacatc | Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol | recBCD genomic deletion | 2026-09-01 09:30:00 | 1 | |
|
pCDH-EF1-mVenus-p27K− Resource Report Resource Website 1+ mentions |
RRID:Addgene_176651 | mVenus-p27K- | Mus musculus | Ampicillin | PMID:34079127 | Backbone Marker:System Biosciences; Backbone Size:7082; Vector Backbone:pCDH; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | Mutant K- (lacks affinity to Cdk) | 2026-09-01 09:30:01 | 5 | |
|
GFP-HP1beta Resource Report Resource Website 1+ mentions |
RRID:Addgene_17651 | HP1 beta | Homo sapiens | Ampicillin | PMID:12560555 | See author's map for more information. | Backbone Marker:Zentgraf Lab; Backbone Size:0; Vector Backbone:pBCHGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:29:59 | 8 | |
|
GFP-HP1alpha Resource Report Resource Website 10+ mentions |
RRID:Addgene_17652 | HP1 alpha | Homo sapiens | Ampicillin | PMID:12560555 | See author's map for more information. | Backbone Marker:Zentgraf Lab; Backbone Size:0; Vector Backbone:pBCHGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:29:59 | 20 | |
|
pEGFP-D50 lamin A Resource Report Resource Website 10+ mentions |
RRID:Addgene_17653 | D50 lamin A | Homo sapiens | Kanamycin | PMID:15750600 | Backbone Marker:Clontech; Backbone Size:4730; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | Delta 50 (50 aa internal deletion in globular tail domain) | 2026-09-01 09:29:59 | 14 | |
|
pHS0570 pET45b(+) T7/LacO His14-MBP-bdSUMO-CRISPR associated IscB-TwinStrep Resource Report Resource Website 1+ mentions |
RRID:Addgene_176534 | CRISPR-associated IscB (Delaware Bay metagenome) | E. coli, Brachypodium distachyon, Delaware Bay metagenome | Ampicillin | PMID:34591643 | Backbone Size:5062; Vector Backbone:pET45b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:29:59 | 2 | ||
|
Lac-I-SceI-Tet Resource Report Resource Website 1+ mentions |
RRID:Addgene_17655 | lac I-SceI tet | Ampicillin | PMID:17486118 | The 256 lac operator repeats (XhoI fragment) and the 96 tet operator repeats (XhoI –SacII fragment) from the p16PCbeta plasmid (gift from D. Spector) were cloned into pBluescript. Between the two fragments a single 18nt I-SceI site was inserted (SalI). lac operator repeat: tggaattgtgagcggataacaatt tet operator repeat: tccctatcagtgatagaga This plasmid is not stable in bacteria. Every bacterial stock made will contain correct and incorrect bacteria and when bacteria are grown, you will get colonies which contain the correct plasmid and others which contain recombinant versions. If you check multiple colonies (10-20) in the samples after streaking out a stab, you should find correct ones. The recipient will need to grow the bacteria, isolate individual colonies check them, and make a prep from the correct one. We recommend processing the stab and screening colonies immediately upon receipt. | Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:29:59 | 4 | ||
|
GFP-UBF Resource Report Resource Website 10+ mentions |
RRID:Addgene_17656 | UBF | Homo sapiens | Kanamycin | PMID:12446911 | Backbone Marker:Clontech; Backbone Size:4730; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-09-01 09:29:59 | 10 | ||
|
GFP-RPA194 Resource Report Resource Website 1+ mentions |
RRID:Addgene_17660 | RPA194 | Mus musculus | Kanamycin | PMID:12446911 | Backbone Size:4730; Vector Backbone:modified pEGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-09-01 09:30:00 | 2 | ||
|
GFP-RRN3/TIF1A Resource Report Resource Website 1+ mentions |
RRID:Addgene_17661 | RRN3/TIF1A | Homo sapiens | Kanamycin | PMID:12446911 | Please note: This plasmid contains a F236L mutation in RRN3 compared to the NCBI reference sequence. It is not known how this mutation affects plasmid function. | Backbone Marker:Clontech; Backbone Size:4730; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | See depositor comments below | 2026-09-01 09:30:00 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.