Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: Imp5
Vector Backbone Description: Backbone Marker:Cytiva; Vector Backbone:pGEX-6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36066346
Proper citation: RRID:Addgene_217965 Copy
Species: Homo sapiens
Genetic Insert: ADGRF3
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:38608683
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_217729 Copy
Species: Homo sapiens
Genetic Insert: Histone H4
Vector Backbone Description: Backbone Marker:Clonetech; Vector Backbone:peGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:36066346
Proper citation: RRID:Addgene_217960 Copy
Species: Homo sapiens
Genetic Insert: Imp5
Vector Backbone Description: Backbone Marker:Clonetech; Vector Backbone:peGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30177573
Proper citation: RRID:Addgene_217963 Copy
Species: Homo sapiens
Genetic Insert: ADGRE1
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:38608683
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_217722 Copy
Species: Homo sapiens
Genetic Insert: ADGRE1
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:38608683
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_217689 Copy
Species: Homo sapiens
Genetic Insert: NASP
Vector Backbone Description: Backbone Marker:Clonetech; Vector Backbone:pIRESpuro2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30177573
Proper citation: RRID:Addgene_217962 Copy
Species: Homo sapiens
Genetic Insert: ADGR6
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:38608683
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_217737 Copy
Species: Homo sapiens
Genetic Insert: ADGRG4
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:38608683
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_217735 Copy
Species: Homo sapiens
Genetic Insert: ADGRF2
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:38608683
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_217695 Copy
Species: Homo sapiens
Genetic Insert: ADGRG1
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:38608683
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_217732 Copy
Species: Homo sapiens
Genetic Insert: ADGRF5
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:38608683
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_217698 Copy
Species: Homo sapiens
Genetic Insert: ADGRL2
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:38608683
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_217740 Copy
Species: Homo sapiens
Genetic Insert: ADGRV1
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:38608683
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_217743 Copy
Species: Homo sapiens
Genetic Insert: acccccaaacctgactgact
Vector Backbone Description: Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37267110
Proper citation: RRID:Addgene_207608 Copy
Species: Homo sapiens
Genetic Insert: NAP1
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_216837 Copy
Species: Homo sapiens
Genetic Insert: HOXC4
Vector Backbone Description: Vector Backbone:pGAL4-DBD-MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38969762
Proper citation: RRID:Addgene_215586 Copy
Species: Homo sapiens
Genetic Insert: Connexin 32-IRES-GCaMP6s
Vector Backbone Description: Vector Backbone:pCW57.1; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39639332
Proper citation: RRID:Addgene_216795 Copy
Species: Homo sapiens
Genetic Insert: HaloTag DKC1
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pHTN HaloTag Promega; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37267110
Proper citation: RRID:Addgene_207578 Copy
Species: Homo sapiens
Genetic Insert: puro resistance cassette flanked by TR locus sequences excluding TR
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pFastBac dual; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37267110
Proper citation: RRID:Addgene_207579 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.