Plasmids   Select Another Resource Report Type

http://www.addgene.org/45602

Species: Mus musculus
Genetic Insert: Diap3 in situ probe
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15664173
Comments: Fragment was amplified using the following primers: AGCAGTTCGCTGTTGTGATG GCACGTTTCTCCTTTTCTGC For in vitro transcription, use the SpeI restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and SP6 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 1589-2321 of BC028920, not bp# 1610-2321 as indicated on plasmid map. The plasmid functions as described in the associated publication.

Proper citation: RRID:Addgene_45602 Copy   

•   Source: Addgene

http://www.addgene.org/45561

Genetic Insert: Puromycin N-acetyl transferase
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression, Bifunctional selection protein; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11515370
Comments: Plasmid pEGFP-puro was constructed by PCR amplification of PuroR coding sequences from pPur (Clontech Laboratories, Palo Alto CA, USA) using upstream (5'-AAGTCCGGACTCAGATCTAGGAGACGACCTTCCATGACCGAGT-3') and downstream (5'-GTTATCTAGATCCGGTGGATCCCGGGCACCGGGCTTGCGGGTCATGCACCA-3') primers, digestion of the PCR product with BglII andBamHI, and ligation into BglII/BamHI digested pEGFP-C1 (Clontech Laboratories). To construct a fusion protein containing both EGFP and PuroR sequences, PuroR coding sequences were ligated into an existing expression cassette for EGFP. The resulting fusion protein was designated EGFP-puro and is contained in plasmid pEGFP-puro. This plasmid contains the strong human cytomegalovirus immediate early promoter (Phcmv), the EGFP puro open reading frame, and the simian virus 40 (SV40) polyadenylation signal. The EGFP-puro protein contains the first 245 amino acids of EGFP. The C-terminal five amino acids of EGFP were deleted and replaced by four linker-encoded amino acids, followed by the complete 200-amino-acid PuroR sequence. The C-terminus is formed by 11 amino acids encoded by vector sequences. The resulting fusion protein (EGFP-puro) confers both green fluorescence and resistance to puromycin when expressed in mammalian cells.

Proper citation: RRID:Addgene_45561 Copy   

•   Source: Addgene

http://www.addgene.org/45547

Species: Homo sapiens
Genetic Insert: hM3D (Gq)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5059; Vector Backbone:pcDNA5/FRT; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17360345
Comments: These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community.

Proper citation: RRID:Addgene_45547 Copy   

•   Source: Addgene

http://www.addgene.org/45539

Species: jellyfish
Genetic Insert: mit-2mutAEQ
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5300; Vector Backbone:pcDNA3.1+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22671130
Comments: Note that numbering of the aequorin mutations in this plasmid is relative to the valine at position 8 in the original sequence from Inouye et al., PNAS 82, 3154 (1985) PubMed ID: 3858813. When compared to this sequence (GenBank ID AAA27720.1) the mutations at N28L and D119A would correspond to N35L and D126A.

Proper citation: RRID:Addgene_45539 Copy   

•   Source: Addgene

http://www.addgene.org/45532

Species: Mus musculus
Genetic Insert: alpha Klotho
Vector Backbone Description: Backbone Size:5710; Vector Backbone:pCR3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:26881702

Proper citation: RRID:Addgene_45532 Copy   

•   Source: Addgene

http://www.addgene.org/45493

Species: Synthetic
Genetic Insert: CAR-GECO1
Vector Backbone Description: Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23452507

Proper citation: RRID:Addgene_45493 Copy   

•   Source: Addgene

http://www.addgene.org/45494

Species: Synthetic
Genetic Insert: R-GECO1.2
Vector Backbone Description: Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23452507

Proper citation: RRID:Addgene_45494 Copy   

•   Source: Addgene

http://www.addgene.org/45769

Species: Homo sapiens
Genetic Insert: hE-cadherin
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11381089
Comments: Partial cDNA for human E-cadherin was provided by D. Rimm (Yale University, New Haven, CT) and subcloned into the pcDNA3 mammalian expression vector (Invitrogen), to generate Addgene plasmid 45772. Sequence analysis revealed that the 3′ end of the gene was missing after nucleotide 2644 (according to EMBL/GenBank/DDBJ under accession number L08599). This resulted in a truncation of the last 35 amino acids of the E-cadherin cytoplasmic domain and, as a result, did not contain the β-catenin binding region, as defined by Stappert and Kemler 1994. The COOH terminus of this truncation mutant (E-cadherin Δ β-catenin) ends at amino acid 844 (NH3-ASLSSD); the frameshift added a single histidine residue before a stop codon is introduced. The full-length human E-cadherin was reengineered using RNA from human A431 cells and the RT-PCR method (Primer A, 5′-TGACACCCGGGACAACGTTTATTA-3′, and Primer C, 5′-CTAGTCTAGACCCCTAGTGGTCCTCG-3′) to generate a 425-bp fragment encoding the missing COOH-terminal residues. This fragment was sub-cloned into the truncated hEcad-Δ 35/pcDNA3 vector (Addgene plasmid 45772) to generate full-length hEcad/pcDNA3 (Addgene plasmid 45769).

Proper citation: RRID:Addgene_45769 Copy   

•   Source: Addgene

http://www.addgene.org/45801

Vector Backbone Description: Backbone Size:3019; Vector Backbone:pBSTNAV; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23804766

Proper citation: RRID:Addgene_45801 Copy   

•   Source: Addgene

http://www.addgene.org/45640

Species: Homo sapiens
Genetic Insert: eIF4GI transcript variant 2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19114555
Comments: For diagnostic digest, an additional PvuI digestion is necessary to distinguish the insert from the vector because of their similar sizes. The EIF4G1 translation contains M432V compared to NP_937884 (NM_198241.2); however the nucleotide change resulting in the amino acid change is more conserved between species, and it is located between functional domains of eIF4G1 (PABP-binding site and eIF4E-binding site), and does not affect its function as a translational factor

Proper citation: RRID:Addgene_45640 Copy   

•   Source: Addgene

http://www.addgene.org/45760

Species: Rattus norvegicus
Genetic Insert: alpha 1A AR
Vector Backbone Description: Backbone Size:4657; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1970822

Proper citation: RRID:Addgene_45760 Copy   

•   Source: Addgene

http://www.addgene.org/45763

Species: Homo sapiens
Genetic Insert: lincRNA-RoR cDNA
Vector Backbone Description: Backbone Marker:Bob Weinberg; Backbone Size:5169; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21057500
Comments: Note that though there are some small discrepancies between Addgene's quality control sequence and the depositor's assembled sequence, they do not affect function.

Proper citation: RRID:Addgene_45763 Copy   

•   Source: Addgene

http://www.addgene.org/45636

Species: Homo sapiens
Genetic Insert: HDAC4
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17873280

Proper citation: RRID:Addgene_45636 Copy   

•   Source: Addgene

http://www.addgene.org/45759

Species: Rattus norvegicus
Genetic Insert: AT1R DRY-AAY
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12746278
Comments: The cDNA of the rat vascular smooth muscle AT1A receptor was donated by Dr. K. E. Bernstein (Emory University, Atlanta, GA). Mutations in the rat AT1A receptor were performed with the Mutagene kit(Bio-Rad Laboratories, Inc., Hercules, CA) N4D mutation is present to prevent glycosylation at this consensus site and steric hindrance of antibody binding.

Proper citation: RRID:Addgene_45759 Copy   

•   Source: Addgene

http://www.addgene.org/45743

Species: Anabaena variabilis
Genetic Insert: Ava3855
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5293; Vector Backbone:pET28b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20813918

Proper citation: RRID:Addgene_45743 Copy   

•   Source: Addgene

http://www.addgene.org/45699

Species: Homo sapiens
Genetic Insert: FGFR2 IIIc
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pBabe puro Gateway; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23786770

Proper citation: RRID:Addgene_45699 Copy   

•   Source: Addgene

http://www.addgene.org/45698

Species: Homo sapiens
Genetic Insert: FGFR2 IIIb
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pBabe puro Gateway; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23786770

Proper citation: RRID:Addgene_45698 Copy   

•   Source: Addgene

http://www.addgene.org/45606

Species: Synthetic
Genetic Insert: FDA60
Vector Backbone Description: Backbone Size:5358; Vector Backbone:peT21b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_45606 Copy   

•   Source: Addgene

http://www.addgene.org/45605

Genetic Insert: FRT-kan-FRT
Vector Backbone Description: Backbone Marker:M. Koob (University of Wisconsin, Madison); Vector Backbone:pANTSγ; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:10829079
Comments: This is a template plasmids for frt-flanked kan cassette. The kan cassette originally came from pCP15. pKD3 and pKD4 are identical except for the region between the FRT sites, so they create an identical scar that has stop codons in all six reading frames. As drawn in the map, this scar has an idealized ribosome binding site and start codon for downstream (rightward) gene expression.

Proper citation: RRID:Addgene_45605 Copy   

•   Source: Addgene

http://www.addgene.org/45790

Genetic Insert: miR125b sponge
Vector Backbone Description: Vector Backbone:MSCV EGFP (MG vector); Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22366319

Proper citation: RRID:Addgene_45790 Copy   

•   Source: Addgene