Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Mentions:yes (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

32,424 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pCRII-Topo Diap3 in situ probe
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_45602 Diap3 in situ probe Mus musculus Ampicillin PMID:15664173 Fragment was amplified using the following primers: AGCAGTTCGCTGTTGTGATG GCACGTTTCTCCTTTTCTGC For in vitro transcription, use the SpeI restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and SP6 promoter for antisense probe generation. Please note that Addgene's sequencing results match bp# 1589-2321 of BC028920, not bp# 1610-2321 as indicated on plasmid map. The plasmid functions as described in the associated publication. Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCRII-Topo; Vector Types:in situ; Bacterial Resistance:Ampicillin fragment contains bp# 1589-2321 of BC028920 2026-09-01 09:55:21 1
pEGFP-puro
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_45561 Puromycin N-acetyl transferase Ampicillin PMID:11515370 Plasmid pEGFP-puro was constructed by PCR amplification of PuroR coding sequences from pPur (Clontech Laboratories, Palo Alto CA, USA) using upstream (5'-AAGTCCGGACTCAGATCTAGGAGACGACCTTCCATGACCGAGT-3') and downstream (5'-GTTATCTAGATCCGGTGGATCCCGGGCACCGGGCTTGCGGGTCATGCACCA-3') primers, digestion of the PCR product with BglII andBamHI, and ligation into BglII/BamHI digested pEGFP-C1 (Clontech Laboratories). To construct a fusion protein containing both EGFP and PuroR sequences, PuroR coding sequences were ligated into an existing expression cassette for EGFP. The resulting fusion protein was designated EGFP-puro and is contained in plasmid pEGFP-puro. This plasmid contains the strong human cytomegalovirus immediate early promoter (Phcmv), the EGFP puro open reading frame, and the simian virus 40 (SV40) polyadenylation signal. The EGFP-puro protein contains the first 245 amino acids of EGFP. The C-terminal five amino acids of EGFP were deleted and replaced by four linker-encoded amino acids, followed by the complete 200-amino-acid PuroR sequence. The C-terminus is formed by 11 amino acids encoded by vector sequences. The resulting fusion protein (EGFP-puro) confers both green fluorescence and resistance to puromycin when expressed in mammalian cells. Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression, Bifunctional selection protein; Bacterial Resistance:Ampicillin 2026-09-01 09:55:20 18
pcDNA5/FRT-HA-hM3D(Gq)
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_45547 hM3D (Gq) Homo sapiens Ampicillin PMID:17360345 These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community. Backbone Marker:Invitrogen; Backbone Size:5059; Vector Backbone:pcDNA5/FRT; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:55:20 16
pcDNA3.1+/mit-2mutAEQ
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_45539 mit-2mutAEQ jellyfish Ampicillin PMID:22671130 Note that numbering of the aequorin mutations in this plasmid is relative to the valine at position 8 in the original sequence from Inouye et al., PNAS 82, 3154 (1985) PubMed ID: 3858813. When compared to this sequence (GenBank ID AAA27720.1) the mutations at N28L and D119A would correspond to N35L and D126A. Backbone Marker:Invitrogen; Backbone Size:5300; Vector Backbone:pcDNA3.1+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Asp119Ala and Asn28Leu 2026-09-01 09:55:20 5
pCMV-Kl-EGFP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_45532 alpha Klotho Mus musculus Ampicillin and Kanamycin PMID:26881702 Backbone Size:5710; Vector Backbone:pCR3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin and Kanamycin 2026-09-01 09:55:20 1
CMV-CAR-GECO1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_45493 CAR-GECO1 Synthetic Ampicillin PMID:23452507 Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin R-GECO1 E163V/I166V/V174T/M176I/F222I/A302P 2026-09-01 09:55:20 3
CMV-R-GECO1.2
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_45494 R-GECO1.2 Synthetic Ampicillin PMID:23452507 Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin R-GECO1 M164R/I166V/V174L/F222L/N267S/S270T/I330M/L419I 2026-09-01 09:55:20 25
hE-cadherin-pcDNA3
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_45769 hE-cadherin Homo sapiens Ampicillin PMID:11381089 Partial cDNA for human E-cadherin was provided by D. Rimm (Yale University, New Haven, CT) and subcloned into the pcDNA3 mammalian expression vector (Invitrogen), to generate Addgene plasmid 45772. Sequence analysis revealed that the 3′ end of the gene was missing after nucleotide 2644 (according to EMBL/GenBank/DDBJ under accession number L08599). This resulted in a truncation of the last 35 amino acids of the E-cadherin cytoplasmic domain and, as a result, did not contain the β-catenin binding region, as defined by Stappert and Kemler 1994. The COOH terminus of this truncation mutant (E-cadherin Δ β-catenin) ends at amino acid 844 (NH3-ASLSSD); the frameshift added a single histidine residue before a stop codon is introduced. The full-length human E-cadherin was reengineered using RNA from human A431 cells and the RT-PCR method (Primer A, 5′-TGACACCCGGGACAACGTTTATTA-3′, and Primer C, 5′-CTAGTCTAGACCCCTAGTGGTCCTCG-3′) to generate a 425-bp fragment encoding the missing COOH-terminal residues. This fragment was sub-cloned into the truncated hEcad-Δ 35/pcDNA3 vector (Addgene plasmid 45772) to generate full-length hEcad/pcDNA3 (Addgene plasmid 45769). Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:55:22 18
pBSTNAV
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_45801 Ampicillin PMID:23804766 Backbone Size:3019; Vector Backbone:pBSTNAV; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:55:23 4
pcDNA3 HA eIF4GI (1-1599)
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_45640 eIF4GI transcript variant 2 Homo sapiens Ampicillin PMID:19114555 For diagnostic digest, an additional PvuI digestion is necessary to distinguish the insert from the vector because of their similar sizes. The EIF4G1 translation contains M432V compared to NP_937884 (NM_198241.2); however the nucleotide change resulting in the amino acid change is more conserved between species, and it is located between functional domains of eIF4G1 (PABP-binding site and eIF4E-binding site), and does not affect its function as a translational factor Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:55:22 5
pCMV5 alpha 1A AR
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_45760 alpha 1A AR Rattus norvegicus Ampicillin PMID:1970822 Backbone Size:4657; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:55:22 1
pBabe-lincRNA-RoR
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_45763 lincRNA-RoR cDNA Homo sapiens Ampicillin PMID:21057500 Note that though there are some small discrepancies between Addgene's quality control sequence and the depositor's assembled sequence, they do not affect function. Backbone Marker:Bob Weinberg; Backbone Size:5169; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-09-01 09:55:22 3
pEGFP-HDAC4
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_45636 HDAC4 Homo sapiens Kanamycin PMID:17873280 Backbone Marker:Clontech; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-09-01 09:55:22 4
pcDNA3.1 AT1R DRY-AAY
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_45759 AT1R DRY-AAY Rattus norvegicus Ampicillin PMID:12746278 The cDNA of the rat vascular smooth muscle AT1A receptor was donated by Dr. K. E. Bernstein (Emory University, Atlanta, GA). Mutations in the rat AT1A receptor were performed with the Mutagene kit(Bio-Rad Laboratories, Inc., Hercules, CA) N4D mutation is present to prevent glycosylation at this consensus site and steric hindrance of antibody binding. Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin changed amino acids 125-126 from DR to AA 2026-09-01 09:55:22 1
pET28b-Ava3855
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_45743 Ava3855 Anabaena variabilis Kanamycin PMID:20813918 Backbone Marker:Novagen; Backbone Size:5293; Vector Backbone:pET28b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-09-01 09:55:22 1
pBp-FGFR2c-WT
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_45699 FGFR2 IIIc Homo sapiens Ampicillin PMID:23786770 Backbone Size:5500; Vector Backbone:pBabe puro Gateway; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-09-01 09:55:22 6
pBp-FGFR2b-WT
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_45698 FGFR2 IIIb Homo sapiens Ampicillin PMID:23786770 Backbone Size:5500; Vector Backbone:pBabe puro Gateway; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-09-01 09:55:22 6
FDA60
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_45606 FDA60 Synthetic Ampicillin Backbone Size:5358; Vector Backbone:peT21b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:55:21 1
pKD4
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_45605 FRT-kan-FRT Ampicillin and Kanamycin PMID:10829079 This is a template plasmids for frt-flanked kan cassette. The kan cassette originally came from pCP15. pKD3 and pKD4 are identical except for the region between the FRT sites, so they create an identical scar that has stop codons in all six reading frames. As drawn in the map, this scar has an idealized ribosome binding site and start codon for downstream (rightward) gene expression. Backbone Marker:M. Koob (University of Wisconsin, Madison); Vector Backbone:pANTSγ; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin 2026-09-01 09:55:21 28
MG-miR125b-sponge-bulge
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_45790 miR125b sponge Ampicillin PMID:22366319 Vector Backbone:MSCV EGFP (MG vector); Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-09-01 09:55:23 2

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.