Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:homo sapiens (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

69,655 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pCL1324
 
Resource Report
Resource Website 		RRID:Addgene_217965 Imp5 Homo sapiens Ampicillin PMID:36066346 Backbone Marker:Cytiva; Vector Backbone:pGEX-6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:20:18 0
HA-MBP-TEVpCS-ADGRF3 CTFdeltaTA-FLAG
 
Resource Report
Resource Website 		RRID:Addgene_217729 ADGRF3 Homo sapiens Bleocin (Zeocin) PMID:38608683 Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint. Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) Deletion of residues 1-758 2026-08-29 01:20:17 0
pCL1318
 
Resource Report
Resource Website 		RRID:Addgene_217960 Histone H4 Homo sapiens Kanamycin PMID:36066346 Backbone Marker:Clonetech; Vector Backbone:peGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin L63A, F66A, I71A 2026-08-29 01:20:18 0
pCL1271
 
Resource Report
Resource Website 		RRID:Addgene_217963 Imp5 Homo sapiens Kanamycin PMID:30177573 Backbone Marker:Clonetech; Vector Backbone:peGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-29 01:20:18 0
HA-MBP-TEVpCS-ADGRE1 CTFdeltaTA-FLAG
 
Resource Report
Resource Website 		RRID:Addgene_217722 ADGRE1 Homo sapiens Bleocin (Zeocin) PMID:38608683 Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint. Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) Deletion of residues 1-590 2026-08-29 01:20:17 0
HA-MBP-TEVpCS-ADGRE1 CTF-FLAG
 
Resource Report
Resource Website 		RRID:Addgene_217689 ADGRE1 Homo sapiens Bleocin (Zeocin) PMID:38608683 Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint. Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) Deletion of residues 1-584 2026-08-29 01:20:17 0
pCL1032
 
Resource Report
Resource Website 		RRID:Addgene_217962 NASP Homo sapiens Ampicillin PMID:30177573 Backbone Marker:Clonetech; Vector Backbone:pIRESpuro2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:20:18 0
HA-MBP-TEVpCS-ADGRG6 CTFdeltaTA-FLAG
 
Resource Report
Resource Website 		RRID:Addgene_217737 ADGR6 Homo sapiens Bleocin (Zeocin) PMID:38608683 Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint. Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) Deletion of residues 1-846 2026-08-29 01:20:20 0
HA-MBP-TEVpCS-ADGRG4 CTFdeltaTA-FLAG
 
Resource Report
Resource Website 		RRID:Addgene_217735 ADGRG4 Homo sapiens Bleocin (Zeocin) PMID:38608683 Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint. Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) Deletion of residues 1-2727 2026-08-29 01:20:17 0
HA-MBP-TEVpCS-ADGRF2 CTF-FLAG
 
Resource Report
Resource Website 		RRID:Addgene_217695 ADGRF2 Homo sapiens Bleocin (Zeocin) PMID:38608683 Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint. Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) Deletion of residues 1-429 2026-08-29 01:20:21 0
HA-MBP-TEVpCS-ADGRG1 CTFdeltaTA-FLAG
 
Resource Report
Resource Website 		RRID:Addgene_217732 ADGRG1 Homo sapiens Bleocin (Zeocin) PMID:38608683 Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint. Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) Deletion of residues 1-388 2026-08-29 01:20:17 0
HA-MBP-TEVpCS-ADGRF5 CTF-FLAG
 
Resource Report
Resource Website 		RRID:Addgene_217698 ADGRF5 Homo sapiens Bleocin (Zeocin) PMID:38608683 Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint. Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) Deletion of residues 1-990 2026-08-29 01:20:17 0
HA-MBP-TEVpCS-ADGRL2 CTFdeltaTA-FLAG
 
Resource Report
Resource Website 		RRID:Addgene_217740 ADGRL2 Homo sapiens Bleocin (Zeocin) PMID:38608683 Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint. Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) Deletion of residues 1-830 2026-08-29 01:20:18 0
HA-MBP-TEVpCS-ADGRV1 CTFdeltaTA-FLAG
 
Resource Report
Resource Website 		RRID:Addgene_217743 ADGRV1 Homo sapiens Bleocin (Zeocin) PMID:38608683 Please visit https://www.biorxiv.org/content/10.1101/2022.07.14.500097v2 for bioRxiv preprint. Backbone Marker:Invitrogen; Vector Backbone:pFuse-hIgG1-Fc2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) Deletion of residues 1-5896 2026-08-29 01:20:18 0
3xMS2 TR knockin sgRNA 2
 
Resource Report
Resource Website 		RRID:Addgene_207608 acccccaaacctgactgact Homo sapiens Ampicillin PMID:37267110 Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:20:22 0
pcDNA3.1_NAP1-eGFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_216837 NAP1 Homo sapiens Ampicillin Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:20:19 1
pGAL4-DBD-HOXC4-WT
 
Resource Report
Resource Website 		RRID:Addgene_215586 HOXC4 Homo sapiens Ampicillin PMID:38969762 Vector Backbone:pGAL4-DBD-MCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:20:19 0
pCW57-Cx32-IRES-GCaMP6s
 
Resource Report
Resource Website 		RRID:Addgene_216795 Connexin 32-IRES-GCaMP6s Homo sapiens Ampicillin PMID:39639332 Vector Backbone:pCW57.1; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-29 01:20:19 0
3xFLAG-Halo-Dyskerin
 
Resource Report
Resource Website 		RRID:Addgene_207578 HaloTag DKC1 Homo sapiens Ampicillin PMID:37267110 Backbone Size:5500; Vector Backbone:pHTN HaloTag Promega; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:20:19 0
TR knockout HRD
 
Resource Report
Resource Website 		RRID:Addgene_207579 puro resistance cassette flanked by TR locus sequences excluding TR Homo sapiens Ampicillin PMID:37267110 Backbone Size:5500; Vector Backbone:pFastBac dual; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:20:19 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch