Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pB80-KIF1A(1-365)-GFP-SSPB(micro) Resource Report Resource Website 1+ mentions |
RRID:Addgene_174629 | KIF1A(1-365)-GFP-SSPB(micro) | Mus musculus | Ampicillin | PMID:32328628 | Internal plasmid ID: WN233 | Vector Backbone:B-actin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | mmKIF1A(aa1-365): Pro202Ala; EGFP: Met1Del; SSPB:Arg73Gln | 2026-09-01 09:29:29 | 1 |
|
H2B-mScarlet- hRec8(297-506)-mNeonGreen Resource Report Resource Website 1+ mentions |
RRID:Addgene_174717 | Rec8 | Homo sapiens | Ampicillin | PMID:34331869 | pNM937 . Please visit https://doi.org/10.1101/2020.11.29.402537 for bioRxiv preprint | Vector Backbone:pBABE-Blast; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 297-506 | 2026-09-01 09:29:30 | 1 |
|
6xHis-MBP-huBfCas12a Resource Report Resource Website 1+ mentions |
RRID:Addgene_174672 | huBfCas12a | Butyrivibrio fibrisolvens | Kanamycin | The vector is obtained from Scott Gradia Lab (Addgene #29656) while the gene is obtained from Feng Zhang Lab (Addgene #92301) . Read the preprint on medRxiv here: https://www.medrxiv.org/content/10.1101/2021.07.21.21260653v1 | Backbone Marker:Scott Gradia Lab; Backbone Size:6462; Vector Backbone:pET; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-09-01 09:29:29 | 1 | ||
|
6xHis-MBP-huMb2Cas12a Resource Report Resource Website 1+ mentions |
RRID:Addgene_174676 | huMb2Cas12a | Moraxella bovoculi AAX08_00205 | Kanamycin | The vector is obtained from Scott Gradia Lab (Addgene #29656) while the gene is obtained from Feng Zhang Lab (Addgene #92292) . Read the preprint on medRxiv here: https://www.medrxiv.org/content/10.1101/2021.07.21.21260653v1 | Backbone Marker:Scott Gradia Lab; Backbone Size:6462; Vector Backbone:pET; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-09-01 09:29:30 | 1 | ||
|
pSA293-CHEQ-seq Resource Report Resource Website 1+ mentions |
RRID:Addgene_174669 | Ampicillin | PMID:34874265 | Backbone Marker:Promega; Backbone Size:3730; Vector Backbone:pGL4.10; Vector Types:Enhancer reporter; Bacterial Resistance:Ampicillin | 2026-09-01 09:29:29 | 1 | ||||
|
pENTR/pTER shEGFP #1 (628-2) Resource Report Resource Website 1+ mentions |
RRID:Addgene_17470 | Enhanced green fluorescent protein shRNA #1 | Kanamycin | PMID:19657394 | shRNA oligo sequence 5'-CGAAGCAGCACGACTTCTTCTTCAAGAGAGAAGAAGTCGTGCTGCTTCTTTTT | Backbone Marker:Invitrogen; Backbone Size:2555; Vector Backbone:pENTR1A; Vector Types:RNAi, Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-09-01 09:29:30 | 1 | ||
|
pLV[Expression]-mCherry:T2A:Hygro-EF1A>Luc2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_174665 | LUC2 | Synthetic | Ampicillin | Backbone Marker:VectorBuilder; Vector Backbone:pLV; Vector Types:Mammalian Expression, Lentiviral, Luciferase; Bacterial Resistance:Ampicillin | 2026-09-01 09:29:29 | 3 | |||
|
pCLXSN(GFP)-hp100 Resource Report Resource Website 1+ mentions |
RRID:Addgene_174734 | P100 | Homo sapiens | Ampicillin | Vector Backbone:pCLXSN(GFP); Vector Types:Retroviral; Bacterial Resistance:Ampicillin | WT | 2026-09-01 09:29:31 | 1 | ||
|
pKO403_lacZ_Sp Resource Report Resource Website 1+ mentions |
RRID:Addgene_174726 | Spectinomycin | PMID:35023783 | Backbone Size:4506; Vector Backbone:pKO403; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin | 2026-09-01 09:29:31 | 1 | ||||
|
pENTR-LUC (w158-1) Resource Report Resource Website 1+ mentions |
RRID:Addgene_17473 | Firefly Luciferase | Kanamycin | PMID:19657394 | Backbone Marker:Invitrogen; Backbone Size:2240; Vector Backbone:pENTR4; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-09-01 09:29:31 | 5 | |||
|
pCMV-PE2-P2A-hMLH1dn Resource Report Resource Website 1+ mentions |
RRID:Addgene_174827 | PE2-P2A-hMLH1dn | Homo sapiens | Ampicillin | PMID:34653350 | Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Detailed in manuscript; deletion of residues 754-756 in MLH1 | 2026-09-01 09:29:32 | 1 | |
|
pCMV-Mm.cargo(Cre) Resource Report Resource Website 1+ mentions |
RRID:Addgene_174862 | Cre flanked by MmPeg10 UTRs | Mus musculus | Ampicillin | PMID:34413232 | Backbone Size:5400; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:29:33 | 1 | ||
|
pAS_8xMmaPylT_EF1_FLAG-MmaPylRS Resource Report Resource Website 1+ mentions |
RRID:Addgene_174890 | Mma PylRS | Methanosarcina mazei | Ampicillin | PMID:34431592 | Backbone Marker:Addgene #140008 based on PB510B-1 (System Bioscience); Vector Backbone:pAS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | U25C PylT | 2026-09-01 09:29:33 | 1 | |
|
pET28_6xHis-PARP1deltaART Resource Report Resource Website 1+ mentions |
RRID:Addgene_174804 | PARP1deltaART | Homo sapiens | Kanamycin | PMID:34465625 | Protein residues 1-784 (V762A) | Vector Backbone:pET28; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Deletion of residues 785-1014 | 2026-09-01 09:29:32 | 1 |
|
pLenti CMV TetR Blast (716-1) Resource Report Resource Website 50+ mentions |
RRID:Addgene_17492 | Tetracycline repressor | Ampicillin | PMID:19657394 | Backbone Size:8477; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-09-01 09:29:34 | 50 | |||
|
pLenti CMV/TO Puro empty (w175-1) Resource Report Resource Website 10+ mentions |
RRID:Addgene_17482 | Ampicillin | PMID:19657394 | Backbone Size:8007; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-09-01 09:29:32 | 18 | ||||
|
pLenti CMV/TO Hygro empty (w214-1) Resource Report Resource Website 10+ mentions |
RRID:Addgene_17484 | Ampicillin | PMID:19657394 | Backbone Size:8709; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-09-01 09:29:32 | 19 | ||||
|
pQCXIB empty (w335-1) Resource Report Resource Website 1+ mentions |
RRID:Addgene_17487 | Ampicillin | PMID:19657394 | Backbone Size:7027; Vector Backbone:pQCXIB; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-09-01 09:29:33 | 7 | ||||
|
px459 sgAtg5 Resource Report Resource Website 1+ mentions |
RRID:Addgene_175023 | ATG5 | Homo sapiens | Ampicillin | PMID:32850845 | Backbone Size:9174; Vector Backbone:px459; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:29:36 | 1 | ||
|
pcDNA3-TORCAR-NES Resource Report Resource Website 1+ mentions |
RRID:Addgene_175015 | TORCAR-NES | Ampicillin | PMID:33257668 | Backbone Marker:Invitrogen; Backbone Size:5472; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:29:35 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
