Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 457 showing 9121 ~ 9140 out of 32,424 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/174629

Species: Mus musculus
Genetic Insert: KIF1A(1-365)-GFP-SSPB(micro)
Vector Backbone Description: Vector Backbone:B-actin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32328628
Comments: Internal plasmid ID: WN233

Proper citation: RRID:Addgene_174629 Copy   


http://www.addgene.org/174717

Species: Homo sapiens
Genetic Insert: Rec8
Vector Backbone Description: Vector Backbone:pBABE-Blast; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34331869
Comments: pNM937 . Please visit https://doi.org/10.1101/2020.11.29.402537 for bioRxiv preprint

Proper citation: RRID:Addgene_174717 Copy   


  • RRID:Addgene_174672

    This resource has 1+ mentions.

http://www.addgene.org/174672

Species: Butyrivibrio fibrisolvens
Genetic Insert: huBfCas12a
Vector Backbone Description: Backbone Marker:Scott Gradia Lab; Backbone Size:6462; Vector Backbone:pET; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin
Comments: The vector is obtained from Scott Gradia Lab (Addgene #29656) while the gene is obtained from Feng Zhang Lab (Addgene #92301) . Read the preprint on medRxiv here: https://www.medrxiv.org/content/10.1101/2021.07.21.21260653v1

Proper citation: RRID:Addgene_174672 Copy   


  • RRID:Addgene_174676

    This resource has 1+ mentions.

http://www.addgene.org/174676

Species: Moraxella bovoculi AAX08_00205
Genetic Insert: huMb2Cas12a
Vector Backbone Description: Backbone Marker:Scott Gradia Lab; Backbone Size:6462; Vector Backbone:pET; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin
Comments: The vector is obtained from Scott Gradia Lab (Addgene #29656) while the gene is obtained from Feng Zhang Lab (Addgene #92292) . Read the preprint on medRxiv here: https://www.medrxiv.org/content/10.1101/2021.07.21.21260653v1

Proper citation: RRID:Addgene_174676 Copy   


  • RRID:Addgene_174669

    This resource has 1+ mentions.

http://www.addgene.org/174669

Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3730; Vector Backbone:pGL4.10; Vector Types:Enhancer reporter; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34874265

Proper citation: RRID:Addgene_174669 Copy   


  • RRID:Addgene_17470

    This resource has 1+ mentions.

http://www.addgene.org/17470

Genetic Insert: Enhanced green fluorescent protein shRNA #1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2555; Vector Backbone:pENTR1A; Vector Types:RNAi, Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19657394
Comments: shRNA oligo sequence 5'-CGAAGCAGCACGACTTCTTCTTCAAGAGAGAAGAAGTCGTGCTGCTTCTTTTT

Proper citation: RRID:Addgene_17470 Copy   


http://www.addgene.org/174665

Species: Synthetic
Genetic Insert: LUC2
Vector Backbone Description: Backbone Marker:VectorBuilder; Vector Backbone:pLV; Vector Types:Mammalian Expression, Lentiviral, Luciferase; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_174665 Copy   


  • RRID:Addgene_174734

    This resource has 1+ mentions.

http://www.addgene.org/174734

Species: Homo sapiens
Genetic Insert: P100
Vector Backbone Description: Vector Backbone:pCLXSN(GFP); Vector Types:Retroviral; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_174734 Copy   


  • RRID:Addgene_174726

    This resource has 1+ mentions.

http://www.addgene.org/174726

Vector Backbone Description: Backbone Size:4506; Vector Backbone:pKO403; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:35023783

Proper citation: RRID:Addgene_174726 Copy   


  • RRID:Addgene_17473

    This resource has 1+ mentions.

http://www.addgene.org/17473

Genetic Insert: Firefly Luciferase
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2240; Vector Backbone:pENTR4; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19657394

Proper citation: RRID:Addgene_17473 Copy   


  • RRID:Addgene_174827

    This resource has 1+ mentions.

http://www.addgene.org/174827

Species: Homo sapiens
Genetic Insert: PE2-P2A-hMLH1dn
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34653350

Proper citation: RRID:Addgene_174827 Copy   


  • RRID:Addgene_174862

    This resource has 1+ mentions.

http://www.addgene.org/174862

Species: Mus musculus
Genetic Insert: Cre flanked by MmPeg10 UTRs
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34413232

Proper citation: RRID:Addgene_174862 Copy   


http://www.addgene.org/174890

Species: Methanosarcina mazei
Genetic Insert: Mma PylRS
Vector Backbone Description: Backbone Marker:Addgene #140008 based on PB510B-1 (System Bioscience); Vector Backbone:pAS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34431592

Proper citation: RRID:Addgene_174890 Copy   


  • RRID:Addgene_174804

    This resource has 1+ mentions.

http://www.addgene.org/174804

Species: Homo sapiens
Genetic Insert: PARP1deltaART
Vector Backbone Description: Vector Backbone:pET28; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34465625
Comments: Protein residues 1-784 (V762A)

Proper citation: RRID:Addgene_174804 Copy   


http://www.addgene.org/17492

Genetic Insert: Tetracycline repressor
Vector Backbone Description: Backbone Size:8477; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19657394

Proper citation: RRID:Addgene_17492 Copy   


http://www.addgene.org/17482

Vector Backbone Description: Backbone Size:8007; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19657394

Proper citation: RRID:Addgene_17482 Copy   


http://www.addgene.org/17484

Vector Backbone Description: Backbone Size:8709; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19657394

Proper citation: RRID:Addgene_17484 Copy   


  • RRID:Addgene_17487

    This resource has 1+ mentions.

http://www.addgene.org/17487

Vector Backbone Description: Backbone Size:7027; Vector Backbone:pQCXIB; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19657394

Proper citation: RRID:Addgene_17487 Copy   


  • RRID:Addgene_175023

    This resource has 1+ mentions.

http://www.addgene.org/175023

Species: Homo sapiens
Genetic Insert: ATG5
Vector Backbone Description: Backbone Size:9174; Vector Backbone:px459; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32850845

Proper citation: RRID:Addgene_175023 Copy   


  • RRID:Addgene_175015

    This resource has 1+ mentions.

http://www.addgene.org/175015

Genetic Insert: TORCAR-NES
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5472; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33257668

Proper citation: RRID:Addgene_175015 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X