Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 458 showing 9141 ~ 9160 out of 32,424 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_175266

    This resource has 1+ mentions.

http://www.addgene.org/175266

Species: Synthetic
Genetic Insert: FUCCI
Vector Backbone Description: Vector Backbone:pISce-Dest; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35266986

Proper citation: RRID:Addgene_175266 Copy   


  • RRID:Addgene_175267

    This resource has 1+ mentions.

http://www.addgene.org/175267

Vector Backbone Description: Vector Backbone:PiggyBac; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35474898

Proper citation: RRID:Addgene_175267 Copy   


  • RRID:Addgene_17531

    This resource has 10+ mentions.

http://www.addgene.org/17531

Species: HIV-1
Genetic Insert: HIV-1 Gag/Pol, Tat, Rev
Vector Backbone Description: Backbone Size:2246; Vector Backbone:pcDNA3.1 (Invitrogen); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14722277

Proper citation: RRID:Addgene_17531 Copy   


  • RRID:Addgene_175283

    This resource has 1+ mentions.

http://www.addgene.org/175283

Species: Caenorhabditis elegans
Genetic Insert: DAF-16a
Vector Backbone Description: Backbone Marker:stratagene; Backbone Size:6000; Vector Backbone:pBSK; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24671950

Proper citation: RRID:Addgene_175283 Copy   


  • RRID:Addgene_175274

    This resource has 1+ mentions.

http://www.addgene.org/175274

Species: Synthetic
Genetic Insert: Reverse tetracycline-controlled transactivator (rtTA)
Vector Backbone Description: Backbone Size:3951; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34824475

Proper citation: RRID:Addgene_175274 Copy   


  • RRID:Addgene_175275

    This resource has 1+ mentions.

http://www.addgene.org/175275

Species: Other
Genetic Insert: EGFP-Synaptobrevin-2; tdTomato
Vector Backbone Description: Backbone Size:4561; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34824475
Comments: Sequencing may be difficult due to secondary structure/dimerization. The following primers have been used in the Xu lab: 5': actcagcgctgcctcagtc (upstream of tdTomato) 3': ggccatgttgttgtcctcggaggaggcggtgc (in tdTomato) 5': gggcatggcaccggcagcaccggcagcggcagc (in tdTomato) 3': gctgaacttgtggccgtttacgtcg (in EGFP) 3': cagggtcagcttgccgtaggtggcatcg (in EGFP)

Proper citation: RRID:Addgene_175275 Copy   


  • RRID:Addgene_175276

    This resource has 1+ mentions.

http://www.addgene.org/175276

Species: Yellow fever virus strain 17D
Genetic Insert: Nonstructural protein 1 (NS1) of YFV-17D; NLS-dTomato
Vector Backbone Description: Backbone Size:4591; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34824475

Proper citation: RRID:Addgene_175276 Copy   


  • RRID:Addgene_175279

    This resource has 1+ mentions.

http://www.addgene.org/175279

Species: Yellow fever virus strain 17D
Genetic Insert: NS1
Vector Backbone Description: Backbone Size:3901; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34824475

Proper citation: RRID:Addgene_175279 Copy   


  • RRID:Addgene_175271

    This resource has 1+ mentions.

http://www.addgene.org/175271

Vector Backbone Description: Vector Backbone:PiggyBac; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35474898
Comments: Selectable marker is flanked by Rox sites for excision with Dre recombinase.

Proper citation: RRID:Addgene_175271 Copy   


  • RRID:Addgene_175273

    This resource has 1+ mentions.

http://www.addgene.org/175273

Species: Yellow fever virus strain 17D
Genetic Insert: Nonstructural protein 1 (NS1) of YFV-17D
Vector Backbone Description: Backbone Size:4470; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34824475

Proper citation: RRID:Addgene_175273 Copy   


http://www.addgene.org/175180

Species: Mus musculus
Genetic Insert: pAAV hSyn FLEX iGluSnFR3 v857.PDGFR
Vector Backbone Description: Backbone Size:4852; Vector Backbone:pAAV hSyn FLEX; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37142767

Proper citation: RRID:Addgene_175180 Copy   


  • RRID:Addgene_17519

    This resource has 1+ mentions.

http://www.addgene.org/17519

Vector Backbone Description: Backbone Size:5247; Vector Backbone:pBRIT-LoxP-HA/FLAG-puro; Vector Types:Mammalian Expression, Retroviral, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18066051

Proper citation: RRID:Addgene_17519 Copy   


  • RRID:Addgene_17521

    This resource has 1+ mentions.

http://www.addgene.org/17521

Species: Mus musculus
Genetic Insert: Pax7
Vector Backbone Description: Backbone Size:5200; Vector Backbone:pBRIT-LoxP-HA/FLAG-puro; Vector Types:Mammalian Expression, Retroviral, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18066051

Proper citation: RRID:Addgene_17521 Copy   


  • RRID:Addgene_175290

    This resource has 1+ mentions.

http://www.addgene.org/175290

Species: Mus musculus
Genetic Insert: Z-lock αTAT
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pTriEx4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31740825

Proper citation: RRID:Addgene_175290 Copy   


  • RRID:Addgene_175173

    This resource has 1+ mentions.

http://www.addgene.org/175173

Genetic Insert: mBeRFP
Vector Backbone Description: Vector Backbone:pcDNA3.1(+); Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34610277

Proper citation: RRID:Addgene_175173 Copy   


  • RRID:Addgene_175362

    This resource has 1+ mentions.

http://www.addgene.org/175362

Vector Backbone Description: Backbone Marker:ExpreS2ion Biotechnologies; Backbone Size:2864; Vector Backbone:pExpreS2-1; Vector Types:Insect Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35600892
Comments: This plasmid is designed for use with the ExpreS2 Platform from ExpreS2ion Biotechnologies. It is intended to be used with the ExpreS2ion cells and media which can be obtained directly from the ExpreS2ion website.

Proper citation: RRID:Addgene_175362 Copy   


  • RRID:Addgene_175358

    This resource has 1+ mentions.

http://www.addgene.org/175358

Species: Mus musculus
Genetic Insert: anti-FLAG M2 light chain
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34121409

Proper citation: RRID:Addgene_175358 Copy   


  • RRID:Addgene_175381

    This resource has 1+ mentions.

http://www.addgene.org/175381

Species: Synthetic
Genetic Insert: GFP-Cre recombinase
Vector Backbone Description: Backbone Size:4561; Vector Backbone:pAAV hSyn; Vector Types:AAV; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_175381 Copy   


  • RRID:Addgene_17533

    This resource has 10+ mentions.

http://www.addgene.org/17533

Genetic Insert: Puromycine Acetyl Transferase
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:0; Vector Backbone:pCoHYGRO; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14513552

Proper citation: RRID:Addgene_17533 Copy   


  • RRID:Addgene_175439

    This resource has 1+ mentions.

http://www.addgene.org/175439

Species: Synthetic
Genetic Insert: TVA-P2A-eGFP-P2A-N2cG
Vector Backbone Description: Backbone Marker:Jordane Dimidschstein (Addgene plasmid # 170853); Vector Backbone:pAAV-VTKS2; Vector Types:AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34758329

Proper citation: RRID:Addgene_175439 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X