Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Mentions:yes (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

32,424 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
CAG FUCCI
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_175266 FUCCI Synthetic Ampicillin PMID:35266986 Vector Backbone:pISce-Dest; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:29:40 1
pPB-EF1a-MegaGate-DD-Hygro
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_175267 Ampicillin PMID:35474898 Vector Backbone:PiggyBac; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:29:40 1
pCD/NL-BH*DDD
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_17531 HIV-1 Gag/Pol, Tat, Rev HIV-1 Ampicillin PMID:14722277 Backbone Size:2246; Vector Backbone:pcDNA3.1 (Invitrogen); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-09-01 09:29:41 27
pJH2930
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_175283 DAF-16a Caenorhabditis elegans Ampicillin PMID:24671950 Backbone Marker:stratagene; Backbone Size:6000; Vector Backbone:pBSK; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:29:40 1
pAAV-rtTA
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_175274 Reverse tetracycline-controlled transactivator (rtTA) Synthetic Ampicillin PMID:34824475 Backbone Size:3951; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-09-01 09:29:40 3
pAAV-SynaptoTAG2
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_175275 EGFP-Synaptobrevin-2; tdTomato Other Ampicillin PMID:34824475 Sequencing may be difficult due to secondary structure/dimerization. The following primers have been used in the Xu lab: 5': actcagcgctgcctcagtc (upstream of tdTomato) 3': ggccatgttgttgtcctcggaggaggcggtgc (in tdTomato) 5': gggcatggcaccggcagcaccggcagcggcagc (in tdTomato) 3': gctgaacttgtggccgtttacgtcg (in EGFP) 3': cagggtcagcttgccgtaggtggcatcg (in EGFP) Backbone Size:4561; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-09-01 09:29:40 1
AAV-Syn-NS1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_175276 Nonstructural protein 1 (NS1) of YFV-17D; NLS-dTomato Yellow fever virus strain 17D Ampicillin PMID:34824475 Backbone Size:4591; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-09-01 09:29:40 1
AAV-TRE-NS1NF
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_175279 NS1 Yellow fever virus strain 17D Ampicillin PMID:34824475 Backbone Size:3901; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-09-01 09:29:40 2
pPB-EF1a-MegaGate-DD-Blast
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_175271 Ampicillin PMID:35474898 Selectable marker is flanked by Rox sites for excision with Dre recombinase. Vector Backbone:PiggyBac; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:29:40 2
pAAV-DIO-NS1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_175273 Nonstructural protein 1 (NS1) of YFV-17D Yellow fever virus strain 17D Ampicillin PMID:34824475 Backbone Size:4470; Vector Backbone:AAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-09-01 09:29:40 1
pAAV.hSyn.FLEX.iGluSnFR3.v857.PDGFR.codonopt
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_175180 pAAV hSyn FLEX iGluSnFR3 v857.PDGFR Mus musculus Ampicillin PMID:37142767 Backbone Size:4852; Vector Backbone:pAAV hSyn FLEX; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-09-01 09:29:38 1
pBRIT HA/FLAG
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_17519 Ampicillin PMID:18066051 Backbone Size:5247; Vector Backbone:pBRIT-LoxP-HA/FLAG-puro; Vector Types:Mammalian Expression, Retroviral, Cre/Lox; Bacterial Resistance:Ampicillin 2026-09-01 09:29:38 1
pBRIT Pax7 FLAG
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_17521 Pax7 Mus musculus Ampicillin PMID:18066051 Backbone Size:5200; Vector Backbone:pBRIT-LoxP-HA/FLAG-puro; Vector Types:Mammalian Expression, Retroviral, Cre/Lox; Bacterial Resistance:Ampicillin 2026-09-01 09:29:39 1
Z-lock αTAT
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_175290 Z-lock αTAT Mus musculus Ampicillin PMID:31740825 Backbone Size:5000; Vector Backbone:pTriEx4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin αTAT (236 amino acids) 2026-09-01 09:29:40 2
pcDNA3.1-mBeRFP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_175173 mBeRFP Ampicillin PMID:34610277 Vector Backbone:pcDNA3.1(+); Vector Types:; Bacterial Resistance:Ampicillin 2026-09-01 09:29:38 1
pExpreS2-2
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_175362 Kanamycin PMID:35600892 This plasmid is designed for use with the ExpreS2 Platform from ExpreS2ion Biotechnologies. It is intended to be used with the ExpreS2ion cells and media which can be obtained directly from the ExpreS2ion website. Backbone Marker:ExpreS2ion Biotechnologies; Backbone Size:2864; Vector Backbone:pExpreS2-1; Vector Types:Insect Expression; Bacterial Resistance:Kanamycin 2026-09-01 09:29:41 1
anti-FLAG M2 light chain
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_175358 anti-FLAG M2 light chain Mus musculus Ampicillin PMID:34121409 Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:29:41 1
pAAV hSyn GFP-Cre
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_175381 GFP-Cre recombinase Synthetic Ampicillin Backbone Size:4561; Vector Backbone:pAAV hSyn; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-09-01 09:29:42 3
pCoPURO
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_17533 Puromycine Acetyl Transferase Ampicillin PMID:14513552 Backbone Marker:Invitrogen; Backbone Size:0; Vector Backbone:pCoHYGRO; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:29:41 13
pAAV-VTKS2-TVA-eGFP-N2cG
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_175439 TVA-P2A-eGFP-P2A-N2cG Synthetic Ampicillin PMID:34758329 Backbone Marker:Jordane Dimidschstein (Addgene plasmid # 170853); Vector Backbone:pAAV-VTKS2; Vector Types:AAV, Cre/Lox; Bacterial Resistance:Ampicillin 2026-09-01 09:29:42 3

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.