Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Backbone Marker:http://partsregistry.org/partsdb/get_part.cgi?part=pSB1A10; Backbone Size:5191; Vector Backbone:pSB1A10; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23727987
Comments: This is a reporter plasmid for measuring terminator strength by inserting terminator of interest between the GFP and RFP, expression driven by a single PBAD promoter inducible by arabinose.
Proper citation: RRID:Addgene_46002 Copy
Genetic Insert: DR-GFPuniv reporter
Vector Backbone Description: Backbone Marker:Jasin Lab (Addgene Plasmid# 26475); Vector Backbone:pDR-GFP; Vector Types:Mammalian Expression, recombination reporter plasmid; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22121229
Comments: Description: Plasmid for in vivo recombination assays. Based on the original pDR-GFP plasmid described in Pierce et al. GenDev (1999) v13p2633.
Use data: Recipient plasmid for (homing) endonuclease target sites in order to assess in vivo activity of an endonuclease. The plasmid contains two non-functional copies of the eGFP gene: the 5’ copy is interrupted by the target site of interest and stop codons; the 3’ copy is truncated on both 5’- and 3’-end. pDR-GFP as is does not fulfill any other purpose than to receive (homing) endonuclease target sites. The recognition site for the endonuclease of interest must be cloned into the XhoI/SacI sites in the upstream eGFP gene, thus obliterating the XhoI, KpnI and SacI sites. Successful cleavage of the cloned target site generates a DSB. This triggers in vivo a homologous recombination event with the
3’ truncated copy of the eGFP which renders the 5’ copy functional. The activity of a given endonuclease can be measured by the number of GFP+ cells generated. The site that is cloned into pDR-GFP must insert a frameshift into the 5’ eGFP-copy and/or contain a stop codon in frame with the upstream sequence of the eGFP gene to assure that the ORF is not functional and no eGFP can be synthesized prior to the DSB repair event. In order to easily screen for the successful insertion of the oligonucleotide pair representing the site of interest, it is useful to integrate a restriction site that is not present in pDR-GFPuniv (e.g. a PvuII site).
Sample oligonucleotide pair:
oligo1 5’-TCGATAGGGATAACAGGGTAATACAGCTGTAAGCT-3’
oligo2 3’- ATCCCTATTGTCCCATTATGTCGACAT -5’
Please note that this plasmid functions as described in the associated publication and according to the depositing laboratory the changes to the EGFP sequence are not a concern.
Proper citation: RRID:Addgene_46085 Copy
Species: Mus musculus
Genetic Insert: Map7-fulllength
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22425998
Proper citation: RRID:Addgene_46076 Copy
Species: Gallus gallus
Genetic Insert: Vcl 884-1066
Vector Backbone Description: Backbone Marker:EMD; Backbone Size:5700; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: CFP subcloned into 15b/V884-1066 (Addgene plasmid 46176) via a PCR strategy which placed Nde sites at the ends of the CFP cDNA and added the spacer region in EGFPC1/V1-1066 at the Cterminus of CFP.
Proper citation: RRID:Addgene_46180 Copy
Species: Synthetic
Genetic Insert: klp-12 targeting sgRNA
Vector Backbone Description: Backbone Size:2641; Vector Backbone:pUC57; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23817069
Comments: gRNA target sequence GATCCACAAGTTACAATTGG
Proper citation: RRID:Addgene_46170 Copy
Species: Gallus gallus
Genetic Insert: Vcl
Vector Backbone Description: Backbone Marker:EMD; Backbone Size:5700; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15195105
Proper citation: RRID:Addgene_46171 Copy
Species: Synthetic
Genetic Insert: unc-119 targeting sgRNA
Vector Backbone Description: Backbone Size:2641; Vector Backbone:pUC57; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23817069
Comments: gRNA target sequence GAATTTTCTGAAATTAAAGA
Proper citation: RRID:Addgene_46169 Copy
Species: Synthetic
Genetic Insert: codon optimized Cas9_SV40 NLS with intron
Vector Backbone Description: Backbone Size:2641; Vector Backbone:pUC57; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23817069
Comments: Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3
Proper citation: RRID:Addgene_46168 Copy
Vector Backbone Description: Backbone Size:9909; Vector Backbone:pUASp; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27694947
Proper citation: RRID:Addgene_46162 Copy
Species: Mus musculus
Genetic Insert: mCD8mCherry
Vector Backbone Description: Backbone Size:9929; Vector Backbone:pQUASp; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_46164 Copy
Species: Gallus gallus
Genetic Insert: Vcl 1-258 (aka VD1) A50I mutation
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16608855
Comments: A50I mutation introduced into EGFP/V1-258 (Addgene plasmid 46270) by QCPCR.
Proper citation: RRID:Addgene_46271 Copy
Species: Gallus gallus
Genetic Insert: Vcl 1-258 (aka VD1)
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16608855
Comments: Nde-Xho fragment from pET15b/Vh1-258 (Addgene plasmid 46173) was subcloned into EGFP/V1-1066 (Addgene plasmid 46265) vector modified to contain unique Nde, Xho sites. Modifications were made by QuikChange PCR to facilitate cloning of cDNAs previously in the pET15b vector. The NdeI site present in the cytomegalovirus promoter region was removed (mutating adenine 234 to thymine), and
a new NdeI site was introduced into the multiple cloning site immediately before the vinculin start codon. Additionally, the 5-XhoI site was removed (mutating cytosine 1345 to adenine), and a 3-XhoI site was introduced 3' to the vinculin cDNA in lieu of a PstI site.
Proper citation: RRID:Addgene_46270 Copy
Species: Gallus gallus
Genetic Insert: Vcl 1-851 A50I mutation
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16608855
Comments: A50I mutation introduced into EGFP/V1-851 (Addgene plasmid 46268) by QCPCR mutation.
Proper citation: RRID:Addgene_46269 Copy
Species: Gallus gallus
Genetic Insert: Vcl T12 mutant
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15728584
Comments: T12 mutation introduced by QuikChange PCR to Addgene plasmid 46265.
Mutant inhibits vinculin autoinhibition by ~ 100 fold, vinculin is partially activated and will bind talin, but not actin (unless both talin and actin are present at same time).
Proper citation: RRID:Addgene_46266 Copy
Species: Gallus gallus
Genetic Insert: Vcl
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15728584
Comments: full length chicken vinculin (EcoRI fragment of p1005 subcloned into EcoRI-cut pEGFP-C1). ATG at bp 1390-1392. TAA at bp 4588-90. EGFP at N-terminus.
Proper citation: RRID:Addgene_46265 Copy
Species: Synthetic
Genetic Insert: QF#7
Vector Backbone Description: Backbone Size:5176; Vector Backbone:pPTGAL4; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.
Proper citation: RRID:Addgene_46136 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: GAL80
Vector Backbone Description: Backbone Size:8938; Vector Backbone:pQUAST; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.
Proper citation: RRID:Addgene_46137 Copy
Species: Synthetic
Genetic Insert: QF#7m1
Vector Backbone Description: Backbone Size:11271; Vector Backbone:pCaSpeR-act5cB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please note that Addgene's sequencing results found a few mismatches/gaps in the actin5c promoter when compared to the full plasmid sequence. The depositing laboratory states that this difference is not a concern for the function of the plasmid.
Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.
Proper citation: RRID:Addgene_46126 Copy
Species: Synthetic
Genetic Insert: LexA-QF
Vector Backbone Description: Backbone Size:7400; Vector Backbone:pattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.
Proper citation: RRID:Addgene_46123 Copy
Species: Synthetic
Genetic Insert: QFBDMD-G4AD
Vector Backbone Description: Backbone Size:7400; Vector Backbone:pattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.
Proper citation: RRID:Addgene_46112 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
